KEY RESOURCE TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-CTCF | Millipore Sigma | Cat#07–729 |
| Goat anti-hamster IgG (H+L) Secondary Antibody | Thermo Fisher Scientific | Cat# 31115 RRID: AB_228247 |
| Cd3e Armenian Hamster anti Mouse (145 2C11) | eBioscience | Cat# 16–0031-82 RRID: AB_468847 |
| Cd28 Golden Syrian Hamster anti Mouse (37.51) | eBioscience | Cat# 16–0281-86 RRID: AB_468921 |
| Biotin anti-B220 (RA3–6B2) | BioLegend | Cat# 103204, RRID:AB_312989 |
| Biotin anti-MHCII (M5/114.15.2) | Thermo Fisher Scientific | Cat# 13–5321-82, RRID:AB_466662 |
| Biotin anti-CD4 (GK1.5) | BioLegend | Cat# 100404, RRID:AB_312689 |
| Biotin anti-CDNK1.1 (PK136) | Thermo Fisher Scientific | Cat#13–5941-85, RRID: AB_466805 |
| Biotin anti-Ter-199 (TER-119) | BioLegend | Cat# 116204, RRID:AB_313705 |
| Biotin anti-GR-1 (RB6–8C5) | BioLegend | Cat# 108404, RRID:AB_313369 |
| APC-eFluor 780 anti-CD45.1 (A20) | Invitrogen | Cat#:47–0453-83 RRID:AB_1582228 |
| Efluor 450 anti-CD45.1 (A20) | Invitrogen | Cat#:48–0453-82 RRID:AB_1272189 |
| FITC anti-CD45.1 (A20) | Invitrogen | Cat#:11–0453-85 RRID: AB_465059 |
| PerCP-Cyanine5.5 anti-CD45.1 (A20) | Invitrogen | Cat#: 45–0453-82 RRID: AB_1107003 |
| APC-Cyanine7 anti-CD45.2 (104) | Biolegend | Cat#109823 RRID:AB_830788 |
| eFluor 450 anti-CD45.2 (104) | Invitrogen | Cat#48–0454-82 RRID:AB_11042125 |
| FITC anti-CD45.2 (104) | Invitrogen | Cat#11–0454-85 RRID: AB_465061 |
| PE-Cyanine7 anti-CD45.2 (104) | Invitrogen | Cat#25–0454-82 RRID: AB_2573350 |
| APC anti-KLRG1 (2F1) | Invitrogen | Cat#17–5893-82 RRID:AB_469469 |
| APC-eFluor780 anti-CD8 (53–6.7) | Invitrogen | Cat#47–0081-82 RRID: AB_1272185 |
| Brilliant Violet 510 anti-CD8a (53–6.7) | BioLegend | Cat#100752 RRID: AB_2563057 |
| Brilliant Violet 711 anti-CD8a (53–6.7) | BioLegend | Cat#100748 RRID: AB_2562100 |
| Pacific Blue anti-CD8a (53–6.7) | BioLegend | Cat#100725 RRID: AB_493425 |
| APC anti-TNF alpha (MP6-XT22) | Invitrogen | Cat#17–7321-82 RRID: AB_469508 |
| APC anti-IFNγ (XMG1.2) | BioLegend | Cat#505810 RRID: AB_315404 |
| PE anti-IFN gamma (XMG1.2) | eBioscience | Cat#12–7311-81 RRID: AB_466193 |
| PE anti-IL2 (JES6–5H4) | eBioscience | Cat#12–7021-82 RRID: AB_466150 |
| PE-Cyanine7 anti-CD127 (A7R34) | Invitrogen | Cat#25–1271-82 RRID: AB_469649 |
| eFluor 450 anti-Ki-67 (SolA15) | Invitrogen | Cat#48–5698-82 RRID:AB_11149124 |
| APC anti-BrdU | BD Pharmingen | Cat#51–23619L RRID:AB_2861367 |
| PE anti-Tbet (4B10) | BioLegend | Cat#644809 RRID: AB_2028583 |
| APC anti-CD62L (MEL-14) | BioLegend | Cat#104412 RRID: AB_313099 |
| Percp-Cyanine5.5 anti-CD69 (H1.2F3) | eBiosience | Cat#45–0691-80 RRID: AB_1210703 |
| PE anti-CD103 (2E7) | Invitrogen | Cat#12–1031-82 RRID: AB_465799 |
| APC anti-CD90.2 (53–2.1) | Invitrogen | Cat#12–0902-82 RRID: AB_465776 |
| Alex Fluor 647 anti-CD90.1 (OX7) | Biolegend | Cat#202508 RRID: AB_492884 |
| PE anti-Ccl3 (MIP-1 alpha) | R&D Systems | Cat#IC450P |
| PE anti-Bcl6 (K112–91) | BD Pharmingen | Cat#561522 RRID:AB_10717126 |
| β-actin | Cell Signaling Technology | Cat# 3700S RRID:AB_2242334 |
| Goat anti-mouse HRP | Santa Cruz Biotechnology | Cat# sc2005 RRID:AB_631736 |
| Goat anti-rabbit HRP | Santa Cruz Biotechnology | Cat# sc2004 RRID:AB_631746 |
| Bacterial and virus strains | ||
| Lymphocytic choriomeningitis virus-Armstrong strain | Milner et al.(34) | N/A |
| Listeria monocytogenes-GP33 | Milner et al.(34) | NA |
| Vesicular stomatitis virus-OVA | Rubinstein et al.(45) | NA |
| Chemicals, peptides, and recombinant proteins | ||
| Collagenase Type I | Worthington Biochemicals | Cat#LS004197 |
| Dithioerythritol | EMD Millipore | Cat#233152 |
| Percoll | Sigma | Cat#P1644 |
| Protein Transport Inhibitor Cocktail | eBioscience | Cat#00–4980-93 |
| H-2Db-restricted peptide GP33–41 | Anaspec | Cat#AS-61296 |
| MACS Streptavidin MicroBeads | Miltenyi Biotec | Cat#130–048-101 |
| DMEM | GIBCO | Cat#11965–092 |
| RPMI 1640 | Corning | Cat310–040-CV |
| 2-Mercaptoethanol | GIBCO | Cat321985–023 |
| HEPES | GIBCO | Cat#15630–080 |
| H-2Kb-restricted OVA257–264 | Invivogen | Cat#vac-sin |
| Hank’s Balanced Salt Solution | Corning | Cat# 20–021-CV |
| Sodium Azide | Sigma | Cat#S8032–100G |
| Opti-MEM | Thermo Fisher Scientific | Cat# 31985070 |
| Polybrene | Thermo Fisher Scientific | Cat#TR1003G |
| Trizol | Ambion | Cat15596026 |
| Isopropanol | Acros Organics | Cat#327270010 |
| Chloroform | Fisher Scientific | Cat#BP1145–1 |
| AMPure XP beads | Beckman Coulter | Cat#A63880 |
| Brilliant II Sybr Green | Agilent Technologies | Cat#600828 |
| Phenol-Chloroform | Invitrogen | Cat#15593049 |
| DPBS | Gibco | Cat#14190250 |
| Concanavalin A beads | Bangs Laboratories | Cat#BP531 |
| CaCl2 | Fisher Scientific | Cat# BP510–500 |
| RNase A | Qiagen | Cat#19101 |
| Glycogen | Millipore Sigma | Cat#10901393001 |
| SDS | Fisher Scientific | Cat#BP166–100 |
| Proteinase K | Fisher Scientific | Cat#BP1700–50 |
| Ethanol | Sigma-Aldrich | Cat#E7023–500ML |
| Maxtract High-density tubes | Qiagen | Cat#129046 |
| KCl | Sigma-Aldrich | Cat#P3911–25G |
| Spermidine | Sigma-Aldrich | Cat#S2501–5G |
| PEG 8000 | Sigma-Aldrich | Cat#202452–500G |
| NaCl | Thermo Fisher Scientific | Cat# S271–500 |
| EDTA | Thermo Fisher Scientific | Cat#17892 |
| EGTA | Sigma Aldrich | Cat#E3889 |
| Triton X-100 | Sigma Aldrich | Cat#X100–5ML |
| cOmplete™, EDTA-free Protease Inhibitor Cocktail | Millipore Sigma | Cat#5056489001 |
| Formaldehyde | Sigma-Aldrich | Cat# FP8775 |
| Glycine | Thermo Fisher Scientific | Cat# BP381–5 |
| Agarose | Thermo Fisher Scientific | Cat# BP1356–500 |
| Benzamidine | Sigma-Aldrich | Cat#B6506–5G |
| Proteinase Inhibitor Cocktail | Calbiochem | Cat#539137–10VL |
| Dynabeads Protein G | Invitrogen | Cat#10003D |
| Tris base | Thermo Fisher Scientific | Cat# BP152–5 |
| NP-40 | Sigma-Aldrich | Cat# 11332473001 |
| NaDOC | Sigma-Aldrich | Cat# D6750–25G |
| Ultrapure Water | Fisher Scientific | Cat# 10–977-015 |
| Quick Ligation Kit | New England Bioscience | Cat# M2200S |
| Quick Ligase | New England Bioscience | Cat#E7337A |
| Nanosep MF Filter Tube | VWR | Cat#29300–642 |
| Sybr Gold | Invitrogen | Cat#S11494 |
| 40% Polyacrylamide | Biorad | Cat# 161–0146 |
| Ammonium Persulfate | VWR | Cat# EM-2300 |
| TEMED | VWR | Cat# PAV3161 |
| 6x loading dye | Thermo Fisher Scientific | Cat# R0631 |
| NaOAC | Thermo Fisher Scientific | Cat# S25531 |
| Glycoblue | Invitrogen | Cat# AM9515 |
| NEBNext High Fidelity 2X PCR Master Mix | New England Bioscience | Cat# M0541L |
| MboI-HF enzyme | New England Bioscience | Cat#R0147 |
| Biotin-14-dATP | Life Technologies | Cat#19523–016 |
| DNA Polymerase (Klenow) | New England Bioscience | Cat#M0210 |
| 10x NEB buffer | New England Bioscience | Cat#B0202 |
| T4 DNA Ligase | New England Bioscience | Cat#M0202 |
| Dynabeads Streptavidin | Life Technologies | Cat#65602 |
| Klenow exo minus | New England Bioscience | Cat#M0212 |
| NEBNext Ultra II Q5 Master Mix | New England Bioscience | Cat#M0544S |
| Critical commercial assays | ||
| BD Cytofix/Cytoperm solution Kit | BD Biosciences | Cat#554714 |
| Foxp3/Transcription Factor Staining Buffer Set | eBiosciences | Cat#00–5523-00 |
| TransIT-LT1 Transfection Reagent | Mirus | Cat#MIR 2300 |
| LS Columns | Miltenyi Biotec | Cat#130–042 |
| APC BrdU Kit | BD Biosciences | Cat#557892 RRID:AB_2861367 |
| FlexiGene Kit | Qiagen | Cat#51206 |
| Superscript II | Thermo Fisher Scientific | Cat#18–064-014 |
| Zymo DNA Clean&Concentrator | Zymo Research | Cat#D4030 |
| End-it DNA End-repair Kit | Lucigen | Cat#ER81050 |
| NEB Library Index | New England Biosciences | Cat#E7600S |
| Qubit dsDNA HS Assay | Thermo Fisher Scientific | Cat#Q32851 |
| Deposited data | ||
| CD8+ T cell histone modifications ChIP | Yu et al. (14) | GSE89036 |
| Patient RNA Seq | Gregor et al.(47); Konrad et al.(48) | GSE46833 |
| Tbet ChIP-Seq | Dominguez et al.(41) | PRJNA287664 |
| Hi-C Sequencing | This paper | GSE205081 |
| Naive and Memory Hi-C Sequencing | Russ et al.(32) | GSE225885 |
| CTCF knockdown RNA Sequencing | This paper | GSE205079 |
| CTCF ChIP-Seq | This paper | GSE205077 |
| Input ChIP-Seq | Yu et al.14 | GSE89036 |
| CTCF Cut&Run | This paper | GSE205077 |
| CTCF knockdown Cut&Run | This paper | GSE205077 |
| CTCF knockdown ATAC | This paper | GSE205076 |
| Experimental models: Cell lines | ||
| B16-GP33–41 | Dr. A. Lamarre, INRS-institut Armand-Frappier | N/A |
| PLAT-E | Cell Biolabs | Cat#RV-101; RRID: CCL_B488 |
| Experimental models: Organisms/strains | ||
| P14 (B6.Cg-Tcratm1MomTg(TcrLCMV)327Sdz/TacMmjax) | The Jackson Laboratory | Cat#037394-JAX; RRID: MMRRC_037394-JAX |
| OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J | The Jackson Laboratory | Cat#003831; RRID: IMRS_JAX:003831 |
| CD45.2 (C57BL/6J) | The Jackson Laboratory | Cat#000664; RRID: IMSR_JAX:000664 |
| CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) | The Jackson Laboratory | Cat#002014; RRID: IMSR_JAX:002014 |
| CD45.1.2 | Bred in-house | NA |
| Oligonucleotides | ||
| CTCF- forward for qPCR: 5’-AGTGAAAATGCTGAGCCGGA-3’ | IDT | NA |
| CTCF-reverse for qPCR: 5’-ATGATGGCTGTTGGCTGGTT-3’ | IDT | NA |
| Hprt-forward for qPCR: 5’-GGCCAGACTTTGTTGGATTT-3’ | IDT | NA |
| Hprt-reverse for qPCR: 5’-CAACTTGCGCTCATCT-3’. | IDT | NA |
| Gapdh-forward for qPCR:5’-AGGTCGGTGTGAACGGATTTG-3’ | IDT | NA |
| Gapdh-reverse for qPCR: 5’-TGTAGACCATGTAGTTGAGGTCA-3’ | IDT | NA |
| CD4 crRNA: 5’- CGGGTACCAGCCTGTTGCAA −3’ |
IDT | NA |
| Thy crRNA: 5’ CGTGTGCTCGGGTATCCCAA −3’ |
IDT | NA |
| Il7r crRNA: 5’-TCCTCCCTGGTTCCCTCCTG-3’ | IDT | NA |
| Ccl3 crRNA: 5’-CGATCCTGTTGGCCACCACG-3’ | IDT | NA |
| Bcl6 crRNA: 5’-ACACTTGCCCAGACACTAGA-3’ | IDT | NA |
| Recombinant DNA | ||
| shCTCF1: TGCTGTTGACAGTGAGCGCCCAGATGAAGACTGAAGTCATTAGTGAAGCCACAGATGTAATGACTTCAGTCTTCATCTGGATGCCTACTGCCTCGGA | Designed in-house | NA |
| shCTCF2: TGCTGTTGACAGTGAGCGAGCAGAGCATTCAGAACAGTGATAGTGAAGCCACAGATGTATCACTGTTCTGAATGCTCTGCCTGCCTACTGCCTCGGA | Designed in-house | NA |
| Screen shRNA (See Table) | Chen et al.(79) | NA |
| pAG-MNase | Meers et al.(80) | RRID:Addgene_123461 |
| Software and algorithms | ||
| FlowJo v10 | Treestar Inc | RRID:SCR_008520 |
| Prism 9 | Graphpad Inc | RRID: SCR_002798 |
| Gene Pattern | Reich et al.(81) | RRID: SCR_003201 |
| GSEA v4.2.2 | Broad Institute | RRID: SCR_003199 |
| HOMER v4.11 | Heinz et al.(82) | RRID: SCR_010881 |
| R v4.1.2 | Team(83) | RRID: SCR_01905 |
| HiCExplorer v3.6 | Ramirez et al.(84); Wolff et al.(85;)Wolff et al.(86) | RRID:SCR_022111 |
| multiHicCompare v1.3.2 | Stansfield et al.(87) | RRID:SCR_022368 |
| Bowtie2 v2.2.6 | Langmead and Salzberg(88) | RRID:SCR_016368 |
| DESeq2 v1.34.0 | Love et al.(79) | RRID:SCR_015687 |
| Bedtools v.2.29.2 | Quinlan(89) | RRID:SCR_006646 |
| featureCounts v2.0.1 | Liao et al.(90) | RRID:SCR_012919 |
| Integrative Genomics Viewer v2.10.0 | Thorvadsdottir et al.(91) | RRID:SCR_011793 |
| MACS2 v2.2.6 | Zhang et al.(92) | RRID:SCR_013291 |
| 10x Genomics Cell Ranger v4.0.0 | Zheng et al.(93) | RRID:SCR_017344 |
| Seurat v3.1.1 | Stuart et al.(94) | RRID:SCR_007322 |
| MAGIC-Impute v3.0.0 | Van Dijk et al.(95) | RRID: SCR_022369 |
| Encode ATAC-Seq Pipeline v2.1.3 | Consortium(96) | RRID:SCR_023100 |
| Encode ChIP-Seq Pipeline v2.1.5 | Consortium(96) | RRID:SCR_021323 |
| Juicer v1.6 | Durand et al.(97) | RRID:SCR_017226 |