Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the sgRNAs.
| Target gene | Name | sgRNA sequence (5’ - 3’) | PAM site | Manufacturer |
|---|---|---|---|---|
| AHR | CRISPR980378_SGM | AAGTCGGTCTCTATGCCGCT | TGG | Invitrogen TrueGuide Synthetic gRNA |
| TFAP2A | CRISPR887200_SGM | GGAGTAAGGATCTTGCGACT | GGG | Invitrogen TrueGuide Synthetic gRNA |
| TFAP2A | CRISPR887208_SGM | TGTAGTCCCTGCGAGGATCC | AGG | Invitrogen TrueGuide Synthetic gRNA |
