| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse CD4-PerCP-Cy5.5 (clone: RM4-5) | Tonbo Biosciences | Cat# 65-0042-U100; RRID: AB_2621876 |
| Anti-mouse CD8a-PerCP-Cy5.5 (clone: 53-6.7) | Tonbo Biosciences | Cat# 65-0081-U100; RRID: AB_2621882 |
| Anti-mouse B220-PerCP-Cy5.5 (clone: RA3-6B2) | Tonbo Biosciences | Cat# 65-0452-U100; RRID: AB_2621892 |
| Anti-mouse B220-APC (clone: RA3-6B2) | BioLegend | Cat# 103212; RRID: AB_312997 |
| Anti-mouse Ter-119-PerCP-Cy5.5 (clone: TER-119) | Tonbo Biosciences | Cat# 65-5921-U100 |
| Anti-mouse Gr1 (Ly-6G/6C)-PerCP-Cy5.5 (clone: RB6-8C5) | BioLegend | Cat# 108428; RRID: AB_893558 |
| Anti-mouse Gr1-PE-Cy7 (clone: RB6-8C5) | Tonbo Biosciences | Cat# 60-5931-U100; RRID: AB_2621870 |
| Anti-mouse Mac1 (CD11b)-PerCP-Cy5.5 (clone: M1/70) | Tonbo Biosciences | Cat# 65-0112-U100; RRID: AB_2621885 |
| Anti-mouse Mac1-PE-Cy7 (clone: M1/70) | Tonbo Biosciences | Cat# 60-0112-U100; RRID: AB_2621836 |
| Anti-mouse CD45.1-PE (clone: A20) | BD Biosciences | Cat# 553776; RRID: AB_395044 |
| Anti-mouse CD45.2-BV421 (clone: 104) | BD Biosciences | Cat# 562895; RRID: AB_2737873 |
| Anti-mouse Sca-1 (Ly-6A/E)-PE-Cy7 (clone: E13-161.7) | BioLegend | Cat# 122514; RRID: AB_756199 |
| Anti-mouse c-Kit (CD117)-APC-Cy7 (clone: 2B8) | BioLegend | Cat# 105826; RRID: AB_1626278 |
| CD117 MicroBeads Mouse | Miltenyi Biotec | Cat# 130-091-224 |
| Anti-mouse CD150-BV421 (clone: TC15-12F12.2) | BioLegend | Cat# 115926; RRID: AB_2562190 |
| Anti-mouse CD48-PE (clone: HM48-1) | BioLegend | Cat# 103406; RRID: AB_313021 |
| Fc-block (anti-mouse CD16/32) (clone: 2.4-G2) | BD Biosciences | Cat# 553142; RRID: AB_394657 |
| Anti-mouse Flt3 (CD135)-APC (clone: A2F10) | BioLegend | Cat# 135310; RRID: AB_2107050 |
| Chemicals, peptides, and recombinant proteins | ||
| PBS | Nacalai Tesque | Cat# 14249-24 |
| DMEM/Ham’s-F12 medium | Nacalai Tesque | Cat# 11581-15 |
| StemSpan SFEM | STEMCELL Technologies | Cat# 09650 |
| StemSpan SFEM II | STEMCELL Technologies | Cat# 09655 |
| Insulin-Transferrin-Selenium-Ethanolamine (ISTX) 1000x | Thermo Fisher Scientific | Cat# 51500-056 |
| 2-Mercapto ethanol (2-ME) 1000x | Thermo Fisher Scientific | Cat# 21985-023 |
| Penicillin | Meiji Seika | PGLD755 |
| Streptomycin sulfate | Meiji Seika | SSDN1013 |
| Fetal bovine serum | Thermo Fisher Scientific | Cat# 10270-106 |
| Bovine serum albumin | Sigma-Aldrich | Cat# A4503-100G |
| Palmitic acid | Wako Pure Chemical Corporation | Cat# 165-00102 |
| Oleic acid | Sigma-Aldrich | Cat# O1383-1G |
| Cholesterol | Sigma-Aldrich | Cat# C3045-5G |
| Methanol | Nacalai Tesque | Cat# 21914-03 |
| Sodium hydroxide | Wako Pure Chemical Corporation | Cat# 191-01665 |
| Recombinant Murine SCF | PeproTech | Cat# 250-03 |
| Recombinant Human TPO | PeproTech | Cat# 300-18 |
| Propidium iodide | Life Technologies | Cat# P3566 |
| TrueCut Cas9 Protein v2 | Thermo Fisher Scientific | Cat# A36496 |
| Critical commercial assays | ||
| CUGA7 sgRNA Synthesis Kit | Nippon Gene | Cat# 314-08691 |
| TaKaRa Ex Taq | Takara Bio Inc | Cat# RR001A |
| Q5 High-Fidelity 2x Master Mix | New England Biolabs | Cat# M0492S |
| Wizard SV Gel and PCR Clean-Up System | Promega | Cat# A9282 |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6JJmsSlc, 8–12 weeks old, male and female | Japan SLC, Inc. | http://www.jslc.co.jp/english/index2.htm |
| Mouse: C57BL/6J-Ly5.1, 8–12 weeks old, male and female | CLEA Japan, Inc | N/A |
| Mouse: C57BL/6-Tg(UBC-GFP)30Scha/J, 8–12 weeks old, male and female | The Jackson Laboratory | JAX stock #004353 |
| Oligonucleotides | ||
| sgRNA Common primer: AAAAGCACCGACTCGGTGCC |
Shiroshita et al.1 | N/A |
| sgRNA Reversed primer: AAAAGCACCGACTCGGTGCCA CTTTTTCAAGTTGATAACGGACT AGCCTTATTTTAACTTGCT ATTT CTAGCTCTAAAAC |
Shiroshita et al.1 | N/A |
| T7-sgRNA target Forward primer for GFP: ttaatacgactcactataGGGCGAGGAGCTGT TCACCGgttttagagctagaaatagc |
Shiroshita et al.1 | |
| UBC-GFP Forward primer: GTTCACCTTGATGCCGTTCT |
Shiroshita et al.1 | N/A |
| UBC-GFP Reverse and sequence primer: CACCCGTTCTGTTGGCTTAT | Shiroshita et al.1 | N/A |
| Software and algorithms | ||
| FlowJo version 10.7.2 | Tree Star | https://www.flowjo.com/solutions/flowjo |
| SnapGene | GLS Biotech | https://www.snapgene.com/ |
| Molecular Biology tool | Benchling | https://www.benchling.com |
| TIDE | Brinkman et al.4 | https://tide.nki.nl |
| ICE | Conant et al.5 | https://ice.synthego.com |
| Prism v7 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| Other | ||
| Neon Transfection System | Thermo Fisher Scientific | Cat# MPK5000 |
| Neon Transfection System 10 μL Kit | Thermo Fisher Scientific | Cat# MPK1096 |
| NanoDrop Onec Microvolume UV-Vis Spectrophotometer | Thermo Fisher Scientific | Cat# ND-ONEC-W |
NaOH and methanol are stored at 25°C. Cas9 protein, FA including palmitic acid and oleic acid, and cholesterol are stored at −30°C. gRNA is stored at −80°C. Antibodies, buffers, and other reagents can be stored at 4°C.