Table 1.
Primers used for gene expression analysis by real-time PCR.
| Abbreviation | Gene name | Sequence (5’-3’) | Amplicon size (bp) | Reference |
|---|---|---|---|---|
| mmp | Myristoylated membrane protein | F: TTGCCCCACTTCCTATTGTC | 122 | (20) |
| R: CCGGTTTTTCAGACTTGGAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.