KEY RESOURCE TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies (working concentration, application*) | ||
| NCX1 Mouse monoclonal (dil. 1:200, WB) | Swant | RRID: AB_2716744 |
| Cardiac Troponin T Antibody Rabbit polyclonal (dil. 1:1000, WB) | Abcam | RRID: AB_956386 |
| HCN4 Mouse monoclonal (S114/10) (dil. 1:200, WB) | NovusBio | RRID: AB_2935644 |
| GAPDH Mouse monoclonal (dil. 1:3000, WB) | Abcam | RRID: AB_2107448 |
| Cardiac Troponin T-APC REA400 (dil. 1:100, FC) | Miltenyi Biotec | RRID: AB_2783887 |
| REA293-APC (dil. 1:100, FC) | Miltenyi Biotec | RRID: AB_2733446 |
| Mouse monoclonal anti-CD56-PE (dil. 1:5, FC) | BD Bioscience | RRID: AB_395906 |
| Mouse monoclonal anti-PDGFRα-APC (dil. 1:10, FC) | R&D System | RRID: AB_883910 |
| Mouse monoclonal IgG1-PE (dil. 1:5, FC) | BD Biosceince | RRID: AB_396091 |
| Mouse monoclonal IgG1-APC (dil. 1:10, FC) | R&D System | RRID: AB_398576 |
| Rabbit monoclonal anti NKX2.5 (dil. 1:200, FC) | Cell Signaling | RRID: AB_2935645 |
| Rabbit IgG1 (dil. 1:500, FC) | Cell Signaling | RRID: AB_1031062 |
| Slow Skeletal Troponin I Mouse monoclonal (dil. 1:200, IHC/IF) | Novus Biological | RRID: AB_2935646 |
| β-Myosin Heavy chain Mouse A4.951 (dil. 1:1, IHC/IF) | Developmental Studies Hybridoma Bank | RRID: AB_528385 |
| Biotin-SP-conjugated AffiniPure Goat anti-Mouse IgG (dil. 1:500, IHC) | Jackson Immunoresearch | RRID: AB_2338557 |
| Cardiac Troponin I Rabbit Monoclonal (dil. 1:100, IF) | Abcam | RRID: AB_869983 |
| MLC2a Mouse monoclonal (dil. 1:500, IF) | BD Life Science | RRID: AB_2739265 |
| MLC2v Rabbit polyclonal (dil. 1:100, IF) | Proteintech | RRID: AB_2147453 |
| Connexin43 Rabbit polyclonal (dil 1:200, IF) | Merck | RRID: AB_476857 |
| Desmin goat polyclonal (dil. 1:100) | Origene | RRID: AB_2935647 |
| Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 680 (dil. 1:1000, IF) | Life Technologies | RRID: AB_141436 |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (dil. 1:1000, IF/FC) | Life Technologies | RRID: AB_143165 |
| Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 (dil. 1:1000, IF) | Life Technologies | RRID: AB_141844 |
| *WB: Western blotting, FC: flow cytometry; IF: Immunofluorescence, IHC: Immunohistochemistry | ||
| Bacterial and virus strains | ||
| 𝛼-Select Gold Efficiency Chemically competent cells | BIOLINE | Cat # BIO-85027 |
| Chemicals, peptides, and recombinant proteins | ||
| Fast Digest Bpil | Thermo Scientific | Cat # FD1014 |
| Fast Digest Mph1103I (NsiI) | Thermo Scientific | Cat # FD0734 |
| Fast Digest Pfi23II (BsiWI) | Thermo Scientific | Cat # FD0854 |
| Fast Digest SgsI (AscI) | Thermo Scientific | Cat # FD1894 |
| Fast Digest NotI | Thermo Scientific | Cat # FD0593 |
| Fast Digest ScaI | Thermo Scientific | Cat # FD0434 |
| Fast Digest BamHI | Thermo Scientific | Cat # FD0054 |
| Fast Digest Bsu15I (ClaI) | Thermo Scientific | Cat # FD0143 |
| Fast Digest NcoI | Thermo Scientific | Cat # FD0575 |
| T4 DNA Ligase Reaction Buffer | New England Bio-Labs | Cat # B0202S |
| Quick Ligation Kit | New England Bio-Labs | Cat # M2200S |
| T4 Polynucleotide Kinase | New England Bio-Labs | Cat # M0201S |
| Ampicillin sodium salt | Sigma-Aldrich | Cat # A0166 |
| LB Agar, Miller (Luria-Bertani) | BD Life Sciences | Cat # 244520 |
| LB Broth, Miller (Luria-Bertani) | BD Life Sciences | Cat # 244620 |
| Granulated Agar | BD Life Sciences | Cat # 214530 |
| OPTI-MEM Reduced Serum Medium | Gibco | Cat # 31985062 |
| GeneJuice Transfection Reagent | Sigma-Aldrich | Cat # 70967–3 |
| DPBS, no calcium, no magnesium | Gibco | Cat # 14190–250 |
| mTeSR Plus | Stem Cell Technologies | Cat # 100–0276 |
| Essential 8™ Medium | Thermo Scientific | Cat # A1517001 |
| Matrigel Growth Factor Reduced (GFR), Phenol Red-free, LDEV-free | Corning | Cat # 356231 |
| rLaminin-521 (human) | Corning | Cat # 354221 |
| Y-27632 dihydrochloride | Tocris | Cat # 1254–50 |
| Versene Solution | Gibco | Cat # 15040066 |
| TrypLE Select | Gibco | Cat # A12177–02 |
| RPMI 1640 medium | Gibco | Cat # 11875119 |
| RPMI 1640 medium, no glucose | Life Technologies | Cat # 11879020 |
| RPMI 1640 medium, no phenol red | Life Technologies | Cat # 11835055 |
| Bovine Serum Albumin, suitable for cell culture | Sigma-Aldrich | Cat # A9418–50G |
| L-Ascorbic Acid 2-phosphate sesquimagnesium salt hydrate | Sigma-Aldrich | Cat # A8960–5G |
| CHIR99021 | Cayman | Cat # 13122 |
| Wnt-C59 | Selleck Chemicals | Cat # S7037 |
| Sodium L-lactate | Sigma-Aldrich | Cat # L7022–10G |
| B-27 Supplement (50X), serum free | Gibco | Cat # 17504044 |
| CryoStor cell cryopreservation media - CS10 | Sigma-Aldrich | Cat # C2874 |
| Q5 High-Fidelity 2X Master Mix | New England Bio- Labs | Cat # M0492S |
| M-MLV Reverse Transcriptase | Invitrogen | Cat # 28025013 |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Invitrogen | Cat # 10777019 |
| SYBR Select Master Mix | Applied Biosystems | Cat # 4472913 |
| SpCas9 2NLS Nuclease | Synthego | NA |
| 4–15% Mini-PROTEAN TGX Precast Protein Gel | Biorad | Cat # 4561084 |
| Immobilon-P membrane (0.45 μm) | Millipore | Cat # IPVH00010 |
| Hematoxylin Solution (Mayer’s, Modified) | Abcam | Cat # ab220365 |
| Hoechst 33342 Solution | Thermo Scientific | Cat # 62249 |
| DNase I | Millipore | Cat # 260913 |
| Fluo-4 AM | Invitrogen | Cat # 14201 |
| Ivabradine hydrochloride | Tocris | Cat # 6542 |
| ML-218 hydrochloride | Tocris | Cat # 4507 |
| Mibefradil dihydrochloride | Tocris | Cat # 2198 |
| Zacopride hydrochloride | Tocris | Cat # 1795 |
| SEA0400 | Tocris | Cat # 6164 |
| KB-R7943 mesylate | Tocris | Cat # 1244 |
| Verapamil hydrochloride | Tocris | Cat # 0654 |
| Cyclosporine A | Cayman | Cat # 12088 |
| Buprenorphine SR-Lab | ZooPharm | NA |
| Euthasol | Virbac | NA |
| Abatacept (CTLA4-Ig) | Bristol-Myers Squibb | NA |
| 4% Paraformaldehyde | Santa Cruz Biotechnology | Cat # sc-281692 |
| Membrane-coated slides | Leica Microsystem | Cat #11600289 |
| VECTASTAIN Elite ABC HRP kit | Vector Laboratories | Cat # PK-6100 |
| SIGMAFAST™ 3,3′-Diaminobenzidine tablets | Sigma-Aldrich | Cat # D4168 |
| HEPES | Fisher | Cat # BP310–500 |
| D-(+)-Glucose | Sigma-Aldrich | Cat # G5767 |
| EGTA | Sigma-Aldrich | Cat # E3889 |
| ATP Magnesium Salt | Sigma-Aldrich | Cat # A9187 |
| Amphotericin B | Sigma-Aldrich | Cat # A9528 |
| Tetraethylammonium Chloride | Sigma-Aldrich | Cat # T2265 |
| 4-Aminopyridine | Sigma-Aldrich | Cat # 275875 |
| Tetraethylammonium Hydroxide | Sigma-Aldrich | Cat # 177806 |
| Cesium Chloride | Sigma-Aldrich | Cat # 289329 |
| GTP Sodium Salt Hydrate | Sigma-Aldrich | Cat # G8877 |
| Cesium Hydroxide Monohydrate | Sigma-Aldrich | Cat # 516988 |
| Critical commercial assays | ||
| QIAEX II Gel Extraction Kit | Qiagen | Cat # 20021 |
| QIAprep Miniprep Kit | Qiagen | Cat # 27104 |
| QIAfilter Plasmid Midiprep Kit | Qiagen | Cat # 12243 |
| BD StemflowTM Human and Mouse Pluripotent Stem Cell Analysis Kit | BD Life Sciences | Cat # 560477 |
| RNAesy Mini kit | Qiagen | Cat # 74106 |
| PicoPure® RNA Isolation Kit | Applied Biosystems | Cat # KIT0204 |
| Leica Laser Microdissection (LMD) System | Leica Microsystem | Cat # 8118616 |
| Pierce BCA Protein assay kit | Thermo Scientific | Cat # 23225 |
| NEBuilder HiFi DNA Assembly Cloning kit | New England Bio- Labs | Cat # E5520S |
| Maestro Pro multiwell microelectrode array (MEA) | Axion Biosystems | Cat #CP-MCV48W-UPF |
| Deposited data | ||
| RNA-seq data set | This paper | GSE190758 |
| Experimental models: Cell lines | ||
| Human induced-pluripotent Stem Cells – 253G1 -Camp3 | Kyoto University | CVCL_B51828 |
| Human Embryonic Stem Cells – RUESe002-A | Rockefeller University | CVCL_C1W369 |
| Experimental models: Organisms/strains | ||
| Athymic male Sprague Dawley rats (Hsd:RH-Foxn1rnu) | Envigo | RGD_5508395 |
| Yucatan minipigs | Premier BioSource | NA |
| Oligonucleotides (see also Methods Tables 1, 2) | ||
| HCN4_gRNA1 TCGTGAAGCGGACAATGCGC | This paper | NA |
| CACNA1H_gRNA1 GGATTTCTTCATCGTCGTGG | This paper | NA |
| CACNA1H_gRNA2 GACCATCTCCACCGCAAAAA | This paper | NA |
| HCN4_gRNA1_KI CAGCTTGTCCATGGCGCCAG | This paper | NA |
| HCN4_gRNA2_KI GGCAGCTTGTCCATGGCGCC | This paper | NA |
| SLC8A1_gRNA1 GGATCATATTACTGTAAGAA | Synthego | NA |
| SLC8A1_gRNA2 CAGCAATTACATGGTCCACA | Synthego | NA |
| SLC8A1_gRNA3 TGAAATCCCATTGAAAAGGT | Synthego | NA |
| Recombinant DNA | ||
| pSpCas9(BB)-2A-Puro (pX459) V2.0 | Addgene | Addgene_6298870 |
| AAV_CAGGS_EGFP | Addgene | Addgene_2221271 |
| MV-PGK-Puro-TK | Hera BioLabs | Cat # SGK-0062 |
| KCNJ2 cDNA cloning fragment (RefSeq: NM_000891.3) | IDT | NA |
| pX330-U6-Chimeric_BB-CBh-hSpCas9 | Addgene | Addgene_42230 |
| Software and algorithms and equipment | ||
| Guidescan (https://guidescan.com/) | Ventura lab | 72 |
| Cas-OFFinder (http://www.rgenome.net/cas-offinder/) | Kim lab | 73 |
| Axis Navigator 2.0.3 | Axion Biosystem | NA |
| Prism 8.4.2 | GraphPad | NA |
| FlowJo V9 | BD Life Sciences | NA |
| SnapGene 5.0.8 | SnapGene | NA |
| ImageJ | Fiji | NA |
| ecgAUTO 3.3.5.10 | EMKA Technologies | NA |
| Graft quantification analysis | This paper | 20 |
| Calcium analysis Fluo4 MatLab | Sniadecki Lab | 62 |
| pClamp 11.1 | Molecular Devices | NA |
| Multiclamp 700B | Molecular Devices | NA |
| Digidata 1550B | Molecular Devices | NA |
| Patchmaster v2×73 | HEKA Elektronik | NA |
| Fitmaster v2×91 | HEKA Elektronik | NA |
| Other | ||
| Karyotype analysis | Diagnostic Cytogenetics, Seattle WA | NA |
| ChemiDoc Imaging system | Biorad | NA |
| Vibratome 7000smz-2 | Camden Instrument | NA |
| NOGA-MyoStar platform | BioSense Webster | NA |
| PBS-0.5 MAG Single-Use Vessel | PBS Biotech | Cat #IA-0.5-D-001 |
| PBS-Mini Mag Drive Bioreactor Base Unit | PBS Biotech | Cat #FA-UNI-B-501 |
| Neon Transfection System | Life Technologies | Cat # MPK5000 |