KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-FLAG | Sigma-Aldrich | Cat#F7425; RRID: AB_439687 |
| Mouse monoclonal anti-E. coli RNA polymerase B | Biolegend | Cat#663006; RRID: AB_2565555 |
| IRDye® Goat 680RD anti-Mouse | Li-Cor | Cat#926–68070; RRID: AB_10956588 |
| IRDye® Goat 800CW anti-Rabbit | Li-Cor | Cat#926–32211; RRID: AB_621843 |
| Bacterial and virus strains | ||
| See Table S7 for a complete list of bacterial strains | ||
| See Table S7 for a complete list of virus strains | ||
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| NAD (β-Nicotinamide Adenine Dinucleotide) | Gold Biotechnology | Cat#N-030–1 |
| Carbenicillin | Gold Biotechnology | Cat#C-103–50 |
| Chloramphenicol | Gold Biotechnology | Cat#C-105–25 |
| Tetracycline Hydrochloride | Gold Biotechnology | Cat#T-101–25 |
| Kanamycin Monosulfate | Gold Biotechnology | Cat#K-120–10 |
| IPTG (Isopropyl-beta-D-thiogalactoside) | Gold Biotechnology | Cat#I2481C |
| X-Gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) | Gold Biotechnology | Cat#X4281C |
| PBS (Phosphate Buffered Saline) | Corning | Cat#21–040-CMX12 |
| DNase I (RNase-free) | New England BioLabs | Cat#M0303S |
| RNase A (Bovine ribonuclease A from pancreas) | VWR Chemicals | Cat#E866–5ML |
| EDTA (Ethylenediaminetetraacetic acid) Disodium, dihydrate | Gold Biotechnology | Cat#E-210 |
| Critical commercial assays | ||
| NAD/NADH-Glo Assay | Promega | Cat#G9071 |
| DNeasy Cleanup Kit | Qiagen | Cat#69506 |
| PureLink RNA Minikit | Invitrogen | Cat#12183018A |
| SuperScript III First-Strand Synthesis System | Invitrogen | Cat#18080051 |
| Tagment DNA Enzyme and Buffer Small Kit | Illumina | Cat#20034197 |
| NEBNext® Multiplex Oligos for Illumina® | New England BioLabs | Cat#E7335S |
| NEBNext® dsDNA Fragmentase | New England BioLabs | Cat#M0348S |
| Deposited data | ||
| Experimental models: Cell lines | ||
| Experimental models: Organisms/strains | ||
| Oligonucleotides | ||
| oAC0025: gccaaaacagccaagctttgggtggtaactagccaagcag | This Study | |
| Recombinant DNA | ||
| See Table S7 for a complete list of plasmids | ||
| Software and algorithms | ||
| Geneious Prime® 2022.2.2 | Biomatters Ltd. | RRID: SCR_010519 |
| PSI-BLAST | Altschul et al.71 | RRID: SCR_001010 |
| JACKHMMER | Potter et al.72 | RRID: SCR_005305 |
| BLASTClust | NCBI | RRID: SCR_016641 |
| HHpred | Zimmermann et al.73 | RRID: SCR_010276 |
| PFAM | Mistry et al.74 | RRID: SCR_004726 |
| PDB | Berman et al.75 | RRID: SCR_012820 |
| Kalign | Lassmann et al.76 | RRID: SCR_011810 |
| Muscle | Edgar et al.77 | RRID: SCR_011812 |
| JPred | Drozdetskiy, et al.78 | RRID: SCR_016504 |
| RoseTTa Fold | Baek et al.79 | |
| IQ-TREE | Minh et al.80 | RRID: SCR_017254 |
| FigTree | tree.bio.ed.ac.uk | RRID: SCR_008515 |
| MAFFT | Katoh et al.89 | RRID: SCR_011811 |
| Adobe Illustrator 2021 | Adobe | RRID: SCR_010279 |
| GraphPad Prism 9.2.0 | GraphPad Software | RRID: SCR_002798 |
| Other | ||