Abstract
Background: Heterozygous, large-scale deletions at 14q24.3-31.1 affecting the neurexin-3 gene have been associated with neurodevelopmental disorders such as autism. Both “de novo” occurrences and inheritance from a healthy parent suggest incomplete penetrance and expressivity, especially in autism spectrum disorder. NRXN3 encodes neurexin-3, a neuronal cell surface protein involved in cell recognition and adhesion, as well as mediating intracellular signaling. NRXN3 is expressed in two distinct isoforms (alpha and beta) generated by alternative promoters and splicing. MM/Results: Using exome sequencing, we identified a monoallelic frameshift variant c.159_160del (p.Gln54AlafsTer50) in the NRXN3 beta isoform (NM_001272020.2) in a 5-year-old girl with developmental delay, autism spectrum disorder, and behavioral issues. This variant was inherited from her mother, who did not have any medical complaints. Discussion: This is the first detailed report of a loss-of-function variant in NRXN3 causing an identical phenotype, as reported for heterozygous large-scale deletions in the same genomic region, thereby confirming NRXN3 as a novel gene for neurodevelopmental disorders with autism.
Keywords: NRXN3, neurodevelopmental disorder, autism, novel disease
1. Introduction
Neurexins were discovered as the major alpha-latrotoxin receptor and vertebrate-specific toxin of the black widow spider (Latrodectus) [1]. The human neurexin family consists of three unrelated genes (NRXN1, NRXN2, and NRXN3) [2]. Neurexins are highly expressed in presynaptic nerve terminals and have important roles in synaptic cell adhesion and neurotransmitter release [3].
Interestingly, in contrast to NRXN1 and NRXN3, NRXN2 unexpectedly represses excitatory synapse assembly in the hippocampus, in which neurexins can be divided into pro- and antisynaptogenic organizers [4]. A number of NRXN3 isoforms, alpha-type and beta-type, are produced by the use of alternative promoters and alternative splicing (https://www.uniprot.org/uniprotkb/Q9HDB5/entry, https://gtexportal.org/home/gene/NRXN3; accessed on 1 April 2023) [5,6,7,8]. The larger, α isoform contains additional exons on the 5’ site [9]. The more abundant β isoforms contain no EGF-like repeats (epidermal growth factor like repeats), but the six laminin/neurexin/sex hormone-binding globulin (LNS) domains, which are found in α isoforms [10]. Additionally, the NRXN1 gene can encode an even shorter neurexin γ isoform [8,11]. Extensive alternative splicing is a hallmark of the NRXN family. Six alternative splicing sites in the α isoforms, and two (shared with α form) in the β isoforms give rise to more than a thousand isoforms, explaining the extreme phenotypic variance in patients and mouse models [7,12,13]. Interestingly, autoantibodies against NRXN1α and NRXN3α might also play a role in the development of encephalitis, schizophrenia-related phenotypes, amnestic cognitive impairment, and depressive symptoms [14,15,16,17,18].
Rare exonic deletions within NRXN1 (MIM #600565) at 2p16.3 are among the most frequently observed copy number variations (CNVs) in autism spectrum disorder (ASD) [2,19,20,21,22,23,24,25,26]. The spectrum of heterozygous deletions in NRXN1 includes ASD, ADHD (attention deficit hyperactivity disorder), intellectual disability, seizures, schizophrenia, mood disorders, and congenital malformations [27]. Variants in NRXN2, although less frequent, have been associated with autism and language delay [28,29]. Moreover, the deletion of Nrxn2 in mice results in autism-related behaviors [30,31]. Other members of the neurexin family are contactin-associated protein-like 1 (CNTNAP1), also termed neurexin 4, and contactin-associated protein-like 2 (CNTNAP2). Variants in CNTNAP1 can cause hypomyelinating neuropathy, congenital, 3 (MIM# 618186), and lethal congenital contracture syndrome 7 (MIM# 616286) [32]. For both disorders, no autistic phenotype was reported, despite delayed development and absent speech being described. CNTNAP2 is required for the radial and longitudinal organization of myelinated axons (https://www.uniprot.org/uniprotkb/Q9UHC6/entry). Variants in CNTNAP2 are reported to cause Pitt–Hopkins-like syndrome 1 (MIM#610042). This autosomal recessive syndrome is characterized by developmental delay, speech delay, and seizures, as well as autism [33,34]. In addition, CNTNAP3-5, which belongs to the neurexin family, was reported to be associated with autism [32]. Neurexin interaction partners such as neurolig-in 1 (NLGN1) (MIM#618830), neuroligin 3 (NLGN3) (MIM#300425), and the calcium/calmodulin-dependent serine protein kinase (CASK) (MIM#300749, 300422) are reported in neurodevelopmental disorders and/or autism etiology and susceptibility [35,36]. Heterozygous deletions of chromosomal region 14q24.3-31.1 involving NRXN3 have been associated with various neuropsychiatric conditions (e.g., ADHD or schizophrenia) and autistic features with/without developmental delay/intellectual disability in a total of 24 individuals from 14 families [37,38,39,40]. No other NDD-linked genes were frequently deleted in 14q24.3.31.1 microdeletion syndrome patients. In 6/14 (43%) of the families, the deletion was dominantly inherited from one parent; in 6/14 (43%) it was de novo, while in 2/14 (14%), the mode of inheritance was not available. Four families showed deletions of exons of the β-isoform; two were inherited from their fathers, and two were de novo [2,41]. The remarkable plethora of different isoforms also partially explains the phenotypic diversity.
Several knock-out mouse models have been generated to analyze the function of the NRXN family. Nrxn1/Nrxn2/Nrxn3 triple knock-out mice revealed that at least two intact α-Nrxn genes are necessary for survival [3,42]. Here, brain morphology was normal at birth; however, the mice showed an impairment of excitatory and inhibitory synaptic transmission. Several constitutional and conditional mouse models revealed a role of β-Nrxn3 in neurotransmitter release, excitatory postsynaptic current, induction of action potential, AMPAR (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor) levels, synapse number, and behavior [43,44,45,46]. It was shown that in Nrxn3 conditional knock-out mice, alternative splicing at SS2 and SS4 regulates the release probability but not the number of inhibitory synapses in the olfactory bulb [47]. Exon 24 encodes an evolutionarily conserved glycosylphosphatidylinositol (GPI) anchor site [48]. Importantly, despite evidence from affected patients with copy number variations, NRXN3 is, to date, not listed as a monogenic disease-relevant gene in OMIM (https://omim.org/entry/600567). Recently, according to ClinVar, a total of 120 NRXN2 variants have been identified, and among those, 5% have ASD [29,49,50,51].
2. Material and Methods
2.1. Whole-Exome Sequencing
We performed exome sequencing from leucocyte-derived DNA from the affected child (singleton exome). The library was prepared by SureSelect60Mbv6 (Agilent) and paired-end sequenced on a HiSeq 4000 platform (Illumina), with a read length of 100 bases [52]. In order to align reads to the human genome assembly hg19, a Burrows-Wheeler Aligner (BWA, v.0.5.87.5) was applied and detection of genetic variation was performed using SAMtools (v 0.1.18), PINDEL (v 0.2.4t), and ExomeDepth (v 1.0.0). The cut-off for biallelic inheritance was set to < 1% allele frequency, while for monoallelic inheritance, it was set to < 0.1%. The number of reference entries was 26,174 exomes in the database at the time of analysis. Samples achieved a 20× coverage of 95.5%. Reads were aligned to the human genome-build GRCh37/hg19 and assessed for sequence alterations using a custom-made bioinformatics tool [52]. Sanger sequencing was performed using standard methods. No array CGH was performed (Figure 1A).
2.2. Web Resources/Tools and Databases Used for the Current Study
DECIPHER; https://www.deciphergenomics.org [53]
ClinVar; https://www.ncbi.nlm.nih.gov/clinvar [54]
gnomAD; https://gnomad.broadinstitute.org [55]
OMIM; https://www.omim.org
UCSC Genome Browser; https://genome.ucsc.edu [56]
UniProt; https://www.uniprot.org [57]
GTEx Portal; https://gtexportal.org
Varsome; https://varsome.com [58]
Denovo-db; https://denovo-db.gs.washington.edu
Genematcher; https://genematcher.org [59]
3. Results
3.1. Clinical Description
This girl is the second child of healthy, non-consanguineous Pakistani parents. Her older sister and younger brother have no medical complaints. Her pregnancy, delivery, anthropometric data at birth, and postnatal adaptation were unremarkable.
She achieved independent walking at the age of 20 months but cannot run or climb at her current age of 50/12 years. She is unresponsive when called by name and does not follow any commands. She does not make any syllables or words nor does she use gestures. She only communicates discomfort by crying. An assessment of her hearing with audiometry was impossible due to non-compliance, but brainstem response evoked audiometry (BERA) showed normal results. She does not make eye contact or seek physical contact with her parents or other individuals.
Her play consists of emptying drawers. She is not toilet-trained and wears diapers. The physical and neurological examinations were unremarkable. The only somatic complaint was constipation, responding well to macrogols. Based on these observations the Austrian developmental screening tool from Jentschura und Janz and the Autism Diagnostic Observation Schedule (ADOS), the diagnosis of a global developmental delay and autism spectrum disorder was made [60].
3.2. Genetic Testing
An autosomal recessive search (frequency < 500 cases) in our in-house exome database containing 26,174 individuals gave 161 non-synonymous variants. An autosomal dominant search (frequency < 5 cases) revealed 302 non-synonymous variants. A total of 38 variants (dominant search) affected genes with a pLI score of 1. Furthermore, 28 CNVs (250 controls allowed) were detected.
An exome analysis revealed a monoallelic frameshift variant in NRXN3 NM_001272020.2 (c.[159_160del];[=] (p.[Gln54AlafsTer50];[=]), which was absent from gnomAD (Figure 1B). Additionally, no further cases with this variant were present in the in-house cohort. The NRXN3 variant was confirmed by Sanger sequencing and found to be inherited from the mother. According to the ACMG (American College of Medical Genetics) guidelines, the variant is classified as likely pathogenic (PVS1, PM2, PP4, and BS2). Alternative promotor usage produces several α and β isoforms [61]. The protein encoded by the β promotor contains a signal sequence of 34 amino acids. The promotor for the β isoforms is located downstream of exon 17. The frameshift mutation affects the 15th amino acid after a signal sequence and, therefore, should lead to a lack of all β isoforms.
Figure 1.
Results of Sanger sequencing and schematic presentation of NRXN3 gene organization. (A): Sanger sequencing of the affected patient and the parents. (B): Schematic presentation of the NRXN3 gene organization showing the two promoters used for generation of long α- and short β-NRXN3 isoforms adapted from Hishimoto et al. (2007) [61]. The NRXN3 LoF variant affects exon β1. The p.Gln54AlafsTer50 variant should cause a complete loss of all NRXN3 β-isoforms in the patient.
4. Discussion
Numerous microdeletion disorders were published prior to the identification of the specific disease genes residing within the critical deletion region. Initially, 9q deletions were linked to Kleefstra syndrome (9q Subtelomeric Deletion Syndrome, 9q34.3 Microdeletion Syndrome, 9qSTDS), and later, it was recognized that single nucleotide variants (SNVs) in the euchromatic histone methyltransferase 1 (EHMT1) gene cause Kleefstra syndrome (MIM#607001) [13]. Further, notable examples include Van-Asperen syndrome/chromosome 17q11.2 deletion syndrome (MIM#613675)l harboring NF1 (Neurofibromatosis 1) (MIM#613113); Koolen–De Vries syndrome, harboring KANSL1 (KAT8 regulatory NSL complex, subunit 1) (MIM#610443); Miller–Dieker syndrome (MIM#247200), harboring PAFAH1B1 (platelet-activating factor acetylhydrolase, isoform 1B, alpha subunit) (MIM#601545); and Smith–Magenis Syndrome/17p11.2 microdeletion syndrome, including RAI1 (retinoic acid-induced gene 1) (MIM#182290) [62,63].
Here, we provide further evidence that NRXN3 is likely the responsible disease gene associated with the phenotype observed in chromosome 14q24.3-31.1 deletions in both human and knock-out mouse models [2,10,41,46]. Reported symptoms include intellectual disability, ADHD, motor delay, aggression, depression, anxiety, facial dysmorphism, language delay, social impairment, learning difficulties, schizophrenia, temper tantrums, color blindness, self-harm obsessions, sleep issues, obesity, delusional and persecutory ideas, seizures, and hypotonia. The individual presented here is the first reported with a maternally inherited SNV in NRXN3 that is associated with an NDD with behavioral features. In gnomAD, six loss-of-function (LoF) variants have been reported. In the “gnomAD v2.1.1. (controls)” subset (60,146 out of 141,456), three LoF variants remain. One variant lies within a non-coding transcript, and the other two affect the last exon, potentially allowing the production of stable transcripts. In summary, there might be no LoF variants in gnomAD controls, pointing to the extremely rare nature of NRXN3 LoF variants. Furthermore, in gnomAD, the following LoF variants are listed: c.1833_1849+5dupAAATCTGGATTTGAAAGGTAAA, c.2497+2_2497+3dupTA p.Arg639Ter, and p.Arg1013GlyfsTer26. The variant p.Arg1013GlyfsTer26 affects the last exon of NRXN3 and might give rise to a stable transcript. For another variant, c.1833_1849+5dupAAATCTGGATTTGAAAGGTAAA, it is unclear whether it influences splicing. In total, there are two potential LoF candidate variants: p.Arg639Ter and c.2497+2_2497+3dupTA. In the database at https://denovo-db.gs.washington.edu, no loss-of-function variants are reported. In DECIPHER, a maternally inherited and likely pathogenic LoF variant (p.Arg176Ter) has been reported [53] in a patient with autistic behavior, delayed speech and language development, and an intellectual disability. We contacted the responsible physician to obtain some additional information. For the individuals mother a speech delay and a mild intellectual disability was reported. No autism was present, once more underlining that penetrance plays an important role in the development of autism in NRXN3 deficiency. A very short clinical description has been published recently [64]. The clinical features of the individual reported in DECIPHER fit well with those of our patient.
Recently, a patient with a NRXN3 missense variant of uncertain significance (p.Arg39Cys) and a neurodevelopmental disorder was described [65]. Additionally, a microdeletion of 7177 base pairs (79176037–79183213) affecting NRXN3 was detected in four patients; two of them were sisters in a Saudi epilepsy cohort [66]. Furthermore, two Iranian families were described with homozygous and compound heterozygous variants characterized by learning disabilities, developmental delays, an inability to walk, and behavioral problems [67].
The variant identified in our study was also deposited on Genematcher. However, no proper matches were present on the Genematcher platform [59]. In detail, totally different clinical features and/or low ACMG ratings, low conservation of the affected residues, and another mode of inheritance of the Genematcher entries led to exclusion. No matches with sufficient evidence were identified.
The clinical features of the two patients (the one presented here and the one in [64]). are similar to those reported in individuals with 14q24.3-31.1 deletions. Although all three variants affect highly conserved residues, prediction algorithms classify the two missense variants, p.Arg1332His (rs200707419) and p.Arg1481Gln (rs768341004) (NM_001330195.2, NP_001317124.1), as “variants of unknown significance” based on PM2 and PP2. The individual carrying the p.Arg1481Gln was compound heterozygous for c.3142 + 3A > G (rs531047390). This splice site mutation scores well in accordance with the ACMG criteria. Analyses of additional patients with an autosomal recessive inheritance are required to demonstrate that NRXN3 can both be inherited by autosomal recessive and the described autosomal dominant mode as seen in the chromosome 14q24.3-31.1 deletions. Additionally, six patients with biallelic NRXN1 mutations were identified, raising the question of whether all neurexin-related disorders (NRXN1, NRXN2, and NRXN3) can be inherited via an autosomal recessive or autosomal dominant mode [34,68,69].
A total of 24 individuals with heterozygous deletions affecting either part or the entire NRXN3 gene have been reported [2,10,41,46]. In six families, the deletions were not detectable in parental leucocyte-derived DNA, and presumably occurred de novo. In another six families, these were inherited from a (healthy) parent, suggesting incomplete penetrance and expressivity, especially for autism [2,41]. Further, the mother in our study did not display any overt symptoms. However, a detailed and complete neuropsychological evaluation was not performed. Therefore, it cannot be excluded that some subtle abnormalities are present. In Sanger sequencing, no signs of a mosaic were obvious, which could explain the lack of symptoms in the mother. No exome sequencing was performed for the mother.
Consistently, it is reported that for the paralogue NRXN1, reduced penetrance and variable expressivity remain challenges for genetic counselling. The estimation of penetrance in previous studies for NRXN1 was between 10.4 and 62.4% for different CNVs. For a large cohort including 67 individuals from 34 families (11 paternal inheritance; 10 maternal inheritance), cascade screening of 71 first-degree relatives of the 21 inherited cases led to the identification of an additional 24 carriers, of whom 13 showed the typical phenotype. Speech delay is the most consistent clinical finding in individuals harboring the NRXN1 deletion. It has been estimated that the penetrance of several key features manifests as global delay (83%), speech delay (94%), intellectual disability (80%), autism spectrum disorder (60%), and seizures (17%) [27]. NRXN1 deletions can be inherited from apparently healthy parents [53]. In addition, incomplete penetrance was observed for variants in CNTNAP2 with presentation in heterozygous carriers ranging from severe to apparently unaffected [70].
In summary, all disorders caused by variants in members of the neurexin family seem to show an incomplete penetrance and/or expressivity that underscore our results. In two families, the mode of inheritance was not available. The main phenotype of our individual (autism spectrum disorder and speech delay) is in line with previously reported cases and mouse models. A fundamental similarity to the clinical features observed in NRXN1 and NRXN2 patients is also present.
5. Conclusions
In summary, heterozygous CNVs encompassing NRXN3, intragenic deletions, and specific monoallelic SNVs in NRXN3 are associated with a neurodevelopmental disorder with behavioral/autistic features. We therefore propose that NRXN3 is a potential novel causative disease gene for neurodevelopmental disorder/autism spectrum disorder.
Author Contributions
R.G.F., S.B.W., J.A.M. and M.P. contributed to the study concept and design. K.B. performed Sanger sequencing. All authors contributed to data acquisition and analysis. R.G.F., S.B.W. and J.A.M. contributed to drafting the manuscript and figures. All authors revised the manuscript. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Land Salzburg (protocol code: 415-E/2552/10-2019; date of approval: 25 November 2019).
Informed Consent Statement
Informed consent was obtained from the parents of the affected individual. Written informed consent has been obtained from the parents to publish this paper.
Data Availability Statement
The data presented in this study are available on request from the corresponding author. The data are not publicly available due to institutional guidelines.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This research was funded by the anniversary fund of the Oesterreichische Nationalbank, grant 18023, to S.B.W and the Austrian science fund (FWF) through the E-Rare project GENOMIT (01GM1920A, I4695-B, genomit.eu) to J.A.M. The APC was funded by the Austrian science fund (FWF) through the E-rare project GENOMIT (01GM1920A, I4695-B, genomit.eu) to J.A.M.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Geppert M., Khvotchev M., Krasnoperov V., Goda Y., Missler M., Hammer R.E., Ichtchenko K., Petrenko A.G., Sudhof T.C. Neurexin Iα is a major alpha-latrotoxin receptor that cooperates in alpha-latrotoxin action. J. Biol. Chem. 1998;273:1705–1710. doi: 10.1074/jbc.273.3.1705. [DOI] [PubMed] [Google Scholar]
- 2.Vaags A.K., Lionel A.C., Sato D., Goodenberger M., Stein Q.P., Curran S., Ogilvie C., Ahn J.W., Drmic I., Senman L., et al. Rare deletions at the neurexin 3 locus in autism spectrum disorder. Am. J. Hum. Genet. 2012;90:133–141. doi: 10.1016/j.ajhg.2011.11.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Missler M., Zhang W., Rohlmann A., Kattenstroth G., Hammer R.E., Gottmann K., Sudhof T.C. α-neurexins couple Ca2+ channels to synaptic vesicle exocytosis. Nature. 2003;423:939–948. doi: 10.1038/nature01755. [DOI] [PubMed] [Google Scholar]
- 4.Lin P.Y., Chen L.Y., Jiang M., Trotter J.H., Seigneur E., Sudhof T.C. Neurexin-2: An inhibitory neurexin that restricts excitatory synapse formation in the hippocampus. Sci. Adv. 2023;9:eadd8856. doi: 10.1126/sciadv.add8856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Gomez A.M., Traunmuller L., Scheiffele P. Neurexins: Molecular codes for shaping neuronal synapses. Nat. Rev. Neurosci. 2021;22:137–151. doi: 10.1038/s41583-020-00415-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hauser D., Behr K., Konno K., Schreiner D., Schmidt A., Watanabe M., Bischofberger J., Scheiffele P. Targeted proteoform mapping uncovers specific Neurexin-3 variants required for dendritic inhibition. Neuron. 2022;110:2094–2109.e10. doi: 10.1016/j.neuron.2022.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Missler M., Sudhof T.C. Neurexins: Three genes and 1001 products. Trends Genet. 1998;14:20–26. doi: 10.1016/S0168-9525(97)01324-3. [DOI] [PubMed] [Google Scholar]
- 8.Noborn F., Sterky F.H. Role of neurexin heparan sulfate in the molecular assembly of synapses—Expanding the neurexin code? FEBS J. 2023;290:252–265. doi: 10.1111/febs.16251. [DOI] [PubMed] [Google Scholar]
- 9.Sudhof T.C. Neuroligins and neurexins link synaptic function to cognitive disease. Nature. 2008;455:903–911. doi: 10.1038/nature07456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Tromp A., Mowry B., Giacomotto J. Neurexins in autism and schizophrenia-a review of patient mutations, mouse models and potential future directions. Mol. Psychiatry. 2021;26:747–760. doi: 10.1038/s41380-020-00944-8. [DOI] [PubMed] [Google Scholar]
- 11.Sterky F.H., Trotter J.H., Lee S.J., Recktenwald C.V., Du X., Zhou B., Zhou P., Schwenk J., Fakler B., Sudhof T.C. Carbonic anhydrase-related protein CA10 is an evolutionarily conserved pan-neurexin ligand. Proc. Natl. Acad. Sci. USA. 2017;114:E1253–E1262. doi: 10.1073/pnas.1621321114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Treutlein B., Gokce O., Quake S.R., Sudhof T.C. Cartography of neurexin alternative splicing mapped by single-molecule long-read mRNA sequencing. Proc. Natl. Acad. Sci. USA. 2014;111:E1291–E1299. doi: 10.1073/pnas.1403244111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ullrich B., Ushkaryov Y.A., Sudhof T.C. Cartography of neurexins: More than 1000 isoforms generated by alternative splicing and expressed in distinct subsets of neurons. Neuron. 1995;14:497–507. doi: 10.1016/0896-6273(95)90306-2. [DOI] [PubMed] [Google Scholar]
- 14.Gresa-Arribas N., Planaguma J., Petit-Pedrol M., Kawachi I., Katada S., Glaser C.A., Simabukuro M.M., Armangue T., Martinez-Hernandez E., Graus F., et al. Human neurexin-3alpha antibodies associate with encephalitis and alter synapse development. Neurology. 2016;86:2235–2242. doi: 10.1212/WNL.0000000000002775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hansen N., Lange C., Maass F., Hassoun L., Bouter C., Stocker W., Schott B.H., Wiltfang J., Fitzner D. Mild Amnestic Cognitive Impairment and Depressive Symptoms in Autoimmune Encephalitis Associated with Serum Anti-Neurexin-3alpha Autoantibodies. Brain Sci. 2021;11:673. doi: 10.3390/brainsci11060673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Shiwaku H., Katayama S., Gao M., Kondo K., Nakano Y., Motokawa Y., Toyoda S., Yoshida F., Hori H., Kubota T., et al. Analyzing schizophrenia-related phenotypes in mice caused by autoantibodies against NRXN1alpha in schizophrenia. Brain Behav. Immun. 2023;111:32–45. doi: 10.1016/j.bbi.2023.03.028. [DOI] [PubMed] [Google Scholar]
- 17.Waters P.J., Irani S.R. Neurexin-3alpha: A new antibody target in autoimmune encephalitis. Neurology. 2016;86:2222–2223. doi: 10.1212/WNL.0000000000002781. [DOI] [PubMed] [Google Scholar]
- 18.Zhu L., Shang Q., Zhao C.W., Dai S., Wu Q. Case report: Anti-neurexin-3alpha-associated autoimmune encephalitis secondary to contrast-induced encephalopathy. Front. Neurol. 2023;14:1060110. doi: 10.3389/fneur.2023.1060110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bena F., Bruno D.L., Eriksson M., van Ravenswaaij-Arts C., Stark Z., Dijkhuizen T., Gerkes E., Gimelli S., Ganesamoorthy D., Thuresson A.C., et al. Molecular and clinical characterization of 25 individuals with exonic deletions of NRXN1 and comprehensive review of the literature. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2013;162:388–403. doi: 10.1002/ajmg.b.32148. [DOI] [PubMed] [Google Scholar]
- 20.Ching M.S., Shen Y., Tan W.H., Jeste S.S., Morrow E.M., Chen X., Mukaddes N.M., Yoo S.Y., Hanson E., Hundley R., et al. Deletions of NRXN1 (neurexin-1) predispose to a wide spectrum of developmental disorders. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2010;153:937–947. doi: 10.1002/ajmg.b.31063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kirov G., Rees E., Walters J.T., Escott-Price V., Georgieva L., Richards A.L., Chambert K.D., Davies G., Legge S.E., Moran J.L., et al. The penetrance of copy number variations for schizophrenia and developmental delay. Biol. Psychiatry. 2014;75:378–385. doi: 10.1016/j.biopsych.2013.07.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Schaaf C.P., Boone P.M., Sampath S., Williams C., Bader P.I., Mueller J.M., Shchelochkov O.A., Brown C.W., Crawford H.P., Phalen J.A., et al. Phenotypic spectrum and genotype-phenotype correlations of NRXN1 exon deletions. Eur. J. Hum. Genet. 2012;20:1240–1247. doi: 10.1038/ejhg.2012.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Vinas-Jornet M., Esteba-Castillo S., Gabau E., Ribas-Vidal N., Baena N., San J., Ruiz A., Coll M.D., Novell R., Guitart M. A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion. Mol. Genet. Genom. Med. 2014;2:512–521. doi: 10.1002/mgg3.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Curran S., Ahn J.W., Grayton H., Collier D.A., Ogilvie C.M. NRXN1 deletions identified by array comparative genome hybridisation in a clinical case series—Further understanding of the relevance of NRXN1 to neurodevelopmental disorders. J. Mol. Psychiatry. 2013;1:4. doi: 10.1186/2049-9256-1-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lal D., Ruppert A.K., Trucks H., Schulz H., de Kovel C.G., Kasteleijn-Nolst Trenite D., Sonsma A.C., Koeleman B.P., Lindhout D., Weber Y.G., et al. Burden analysis of rare microdeletions suggests a strong impact of neurodevelopmental genes in genetic generalised epilepsies. PLoS Genet. 2015;11:e1005226. doi: 10.1371/journal.pgen.1005226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Moller R.S., Weber Y.G., Klitten L.L., Trucks H., Muhle H., Kunz W.S., Mefford H.C., Franke A., Kautza M., Wolf P., et al. Exon-disrupting deletions of NRXN1 in idiopathic generalized epilepsy. Epilepsia. 2013;54:256–264. doi: 10.1111/epi.12078. [DOI] [PubMed] [Google Scholar]
- 27.Al Shehhi M., Forman E.B., Fitzgerald J.E., McInerney V., Krawczyk J., Shen S., Betts D.R., Ardle L.M., Gorman K.M., King M.D., et al. NRXN1 deletion syndrome; phenotypic and penetrance data from 34 families. Eur. J. Med. Genet. 2019;62:204–209. doi: 10.1016/j.ejmg.2018.07.015. [DOI] [PubMed] [Google Scholar]
- 28.Gauthier J., Siddiqui T.J., Huashan P., Yokomaku D., Hamdan F.F., Champagne N., Lapointe M., Spiegelman D., Noreau A., Lafreniere R.G., et al. Truncating mutations in NRXN2 and NRXN1 in autism spectrum disorders and schizophrenia. Hum. Genet. 2011;130:563–573. doi: 10.1007/s00439-011-0975-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Rochtus A.M., Trowbridge S., Goldstein R.D., Sheidley B.R., Prabhu S.P., Haynes R., Kinney H.C., Poduri A.H. Mutations in NRXN1 and NRXN2 in a patient with early-onset epileptic encephalopathy and respiratory depression. Cold Spring Harb. Mol. Case Stud. 2019;5:a003442. doi: 10.1101/mcs.a003442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Born G., Grayton H.M., Langhorst H., Dudanova I., Rohlmann A., Woodward B.W., Collier D.A., Fernandes C., Missler M. Genetic targeting of NRXN2 in mice unveils role in excitatory cortical synapse function and social behaviors. Front. Synaptic Neurosci. 2015;7:3. doi: 10.3389/fnsyn.2015.00003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Dachtler J., Glasper J., Cohen R.N., Ivorra J.L., Swiffen D.J., Jackson A.J., Harte M.K., Rodgers R.J., Clapcote S.J. Deletion of α-neurexin II results in autism-related behaviors in mice. Transl. Psychiatry. 2014;4:e484. doi: 10.1038/tp.2014.123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Li W., Yang L., Tang C., Liu K., Lu Y., Wang H., Yan K., Qiu Z., Zhou W. Mutations of CNTNAP1 led to defects in neuronal development. JCI Insight. 2020;5:e135697. doi: 10.1172/jci.insight.135697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Peippo M.M., Simola K.O., Valanne L.K., Larsen A.T., Kahkonen M., Auranen M.P., Ignatius J. Pitt-Hopkins syndrome in two patients and further definition of the phenotype. Clin. Dysmorphol. 2006;15:47–54. doi: 10.1097/01.mcd.0000184973.14775.32. [DOI] [PubMed] [Google Scholar]
- 34.Zweier C., de Jong E.K., Zweier M., Orrico A., Ousager L.B., Collins A.L., Bijlsma E.K., Oortveld M.A., Ekici A.B., Reis A., et al. CNTNAP2 and NRXN1 are mutated in autosomal-recessive Pitt-Hopkins-like mental retardation and determine the level of a common synaptic protein in Drosophila. Am. J. Hum. Genet. 2009;85:655–666. doi: 10.1016/j.ajhg.2009.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Dawson W.O. Time-course of cowpea chlorotic mottle virus RNA replication. Intervirology. 1978;9:119–128. doi: 10.1159/000148929. [DOI] [PubMed] [Google Scholar]
- 36.Najm J., Horn D., Wimplinger I., Golden J.A., Chizhikov V.V., Sudi J., Christian S.L., Ullmann R., Kuechler A., Haas C.A., et al. Mutations of CASK cause an X-linked brain malformation phenotype with microcephaly and hypoplasia of the brainstem and cerebellum. Nat. Genet. 2008;40:1065–1067. doi: 10.1038/ng.194. [DOI] [PubMed] [Google Scholar]
- 37.Faheem M., Naseer M.I., Chaudhary A.G., Kumosani T.A., Rasool M., Algahtani H.A., Bibi F., Kamal M.A., Al-Qahtani M.H. Array-comparative genomic hybridization analysis of a cohort of Saudi patients with epilepsy. CNS Neurol. Disord. Drug. Targets. 2015;14:468–475. doi: 10.2174/1871527314666150429111737. [DOI] [PubMed] [Google Scholar]
- 38.Griswold A.J., Ma D., Cukier H.N., Nations L.D., Schmidt M.A., Chung R.H., Jaworski J.M., Salyakina D., Konidari I., Whitehead P.L., et al. Evaluation of copy number variations reveals novel candidate genes in autism spectrum disorder-associated pathways. Hum. Mol. Genet. 2012;21:3513–3523. doi: 10.1093/hmg/dds164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Nicita F., Di Giacomo M., Palumbo O., Ferri E., Maiorani D., Vigevano F., Carella M., Capuano A. Neurological features of 14q24–q32 interstitial deletion: Report of a new case. Mol. Cytogenet. 2015;8:93. doi: 10.1186/s13039-015-0196-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Riegel M., Moreira L.M., Espirito Santo L.D., Toralles M.B., Schinzel A. Interstitial 14q24.3 to q31.3 deletion in a 6-year-old boy with a non-specific dysmorphic phenotype. Mol. Cytogenet. 2014;7:77. doi: 10.1186/s13039-014-0077-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Yuan H., Wang Q., Liu Y., Yang W., He Y., Gusella J.F., Song J., Shen Y. A rare exonic NRXN3 deletion segregating with neurodevelopmental and neuropsychiatric conditions in a three-generation Chinese family. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2018;177:589–595. doi: 10.1002/ajmg.b.32673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zhang W., Rohlmann A., Sargsyan V., Aramuni G., Hammer R.E., Sudhof T.C., Missler M. Extracellular domains of α-neurexins participate in regulating synaptic transmission by selectively affecting N- and P/Q-type Ca2+ channels. J. Neurosci. 2005;25:4330–4342. doi: 10.1523/JNEUROSCI.0497-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Anderson G.R., Aoto J., Tabuchi K., Foldy C., Covy J., Yee A.X., Wu D., Lee S.J., Chen L., Malenka R.C., et al. β-Neurexins Control Neural Circuits by Regulating Synaptic Endocannabinoid Signaling. Cell. 2015;162:593–606. doi: 10.1016/j.cell.2015.06.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Aoto J., Foldy C., Ilcus S.M., Tabuchi K., Sudhof T.C. Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses. Nat. Neurosci. 2015;18:997–1007. doi: 10.1038/nn.4037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Aoto J., Martinelli D.C., Malenka R.C., Tabuchi K., Sudhof T.C. Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking. Cell. 2013;154:75–88. doi: 10.1016/j.cell.2013.05.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Chen L.Y., Jiang M., Zhang B., Gokce O., Sudhof T.C. Conditional Deletion of All Neurexins Defines Diversity of Essential Synaptic Organizer Functions for Neurexins. Neuron. 2017;94:611–625.e4. doi: 10.1016/j.neuron.2017.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 47.Trotter J.H., Wang C.Y., Zhou P., Nakahara G., Sudhof T.C. A combinatorial code of neurexin-3 alternative splicing controls inhibitory synapses via a trans-synaptic dystroglycan signaling loop. Nat. Commun. 2023;14:1771. doi: 10.1038/s41467-023-36872-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Oku S., Siddiqui T.J. A GPI-anchored Neurexin 3 proteoform mediates dendritic inhibition. Neuron. 2022;110:2041–2044. doi: 10.1016/j.neuron.2022.06.005. [DOI] [PubMed] [Google Scholar]
- 49.Khoja S., Haile M.T., Chen L.Y. Advances in neurexin studies and the emerging role of neurexin-2 in autism spectrum disorder. Front. Mol. Neurosci. 2023;16:1125087. doi: 10.3389/fnmol.2023.1125087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Mohrmann I., Gillessen-Kaesbach G., Siebert R., Caliebe A., Hellenbroich Y. A de novo 0.57 Mb microdeletion in chromosome 11q13.1 in a patient with speech problems, autistic traits, dysmorphic features and multiple endocrine neoplasia type 1. Eur. J. Med. Genet. 2011;54:e461–e464. doi: 10.1016/j.ejmg.2011.04.006. [DOI] [PubMed] [Google Scholar]
- 51.Boyle M.I., Jespersgaard C., Nazaryan L., Ravn K., Brondum-Nielsen K., Bisgaard A.M., Tumer Z. Deletion of 11q12.3–11q13.1 in a patient with intellectual disability and childhood facial features resembling Cornelia de Lange syndrome. Gene. 2015;572:130–134. doi: 10.1016/j.gene.2015.07.016. [DOI] [PubMed] [Google Scholar]
- 52.Wagner M., Berutti R., Lorenz-Depiereux B., Graf E., Eckstein G., Mayr J.A., Meitinger T., Ahting U., Prokisch H., Strom T.M., et al. Mitochondrial DNA mutation analysis from exome sequencing-A more holistic approach in diagnostics of suspected mitochondrial disease. J. Inherit. Metab. Dis. 2019;42:909–917. doi: 10.1002/jimd.12109. [DOI] [PubMed] [Google Scholar]
- 53.Firth H.V., Richards S.M., Bevan A.P., Clayton S., Corpas M., Rajan D., Van Vooren S., Moreau Y., Pettett R.M., Carter N.P. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. Am. J. Hum. Genet. 2009;84:524–533. doi: 10.1016/j.ajhg.2009.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Landrum M.J., Lee J.M., Benson M., Brown G.R., Chao C., Chitipiralla S., Gu B., Hart J., Hoffman D., Jang W., et al. ClinVar: Improving access to variant interpretations and supporting evidence. Nucleic Acids Res. 2018;46:D1062–D1067. doi: 10.1093/nar/gkx1153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Karczewski K.J., Francioli L.C., Tiao G., Cummings B.B., Alfoldi J., Wang Q., Collins R.L., Laricchia K.M., Ganna A., Birnbaum D.P., et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature. 2020;581:434–443. doi: 10.1038/s41586-020-2308-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Kent W.J., Sugnet C.W., Furey T.S., Roskin K.M., Pringle T.H., Zahler A.M., Haussler D. The human genome browser at UCSC. Genome Res. 2002;12:996–1006. doi: 10.1101/gr.229102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.UniProt C. UniProt: The Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2023;51:D523–D531. doi: 10.1093/nar/gkac1052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kopanos C., Tsiolkas V., Kouris A., Chapple C.E., Albarca Aguilera M., Meyer R., Massouras A. VarSome: The human genomic variant search engine. Bioinformatics. 2019;35:1978–1980. doi: 10.1093/bioinformatics/bty897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Sobreira N., Schiettecatte F., Valle D., Hamosh A. GeneMatcher: A matching tool for connecting investigators with an interest in the same gene. Hum. Mutat. 2015;36:928–930. doi: 10.1002/humu.22844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Lord C., Risi S., Lambrecht L., Cook E.H., Jr., Leventhal B.L., DiLavore P.C., Pickles A., Rutter M. The autism diagnostic observation schedule-generic: A standard measure of social and communication deficits associated with the spectrum of autism. J. Autism Dev. Disord. 2000;30:205–223. doi: 10.1023/A:1005592401947. [DOI] [PubMed] [Google Scholar]
- 61.Hishimoto A., Liu Q.R., Drgon T., Pletnikova O., Walther D., Zhu X.G., Troncoso J.C., Uhl G.R. Neurexin 3 polymorphisms are associated with alcohol dependence and altered expression of specific isoforms. Hum. Mol. Genet. 2007;16:2880–2891. doi: 10.1093/hmg/ddm247. [DOI] [PubMed] [Google Scholar]
- 62.Koolen D.A., Morgan A., de Vries B.B.A. Koolen-de Vries Syndrome. In: Adam M.P., Everman D.B., Mirzaa G.M., Pagon R.A., Wallace S.E., Bean L.J.H., Gripp K.W., Amemiya A., editors. GeneReviews®. Springer; Seattle, WA, USA: 1993. [Google Scholar]
- 63.Smith A.C.M., Boyd K.E., Brennan C., Charles J., Elsea S.H., Finucane B.M., Foster R., Gropman A., Girirajan S., Haas-Givler B. Smith-Magenis Syndrome. In: Adam M.P., Everman D.B., Mirzaa G.M., Pagon R.A., Wallace S.E., Bean L.J.H., Gripp K.W., Amemiya A., editors. GeneReviews®. Springer; Seattle, WA, USA: 1993. [Google Scholar]
- 64.Krgovic D., Gorenjak M., Rihar N., Opalic I., Stangler Herodez S., Gregoric Kumperscak H., Dovc P., Kokalj Vokac N. Impaired Neurodevelopmental Genes in Slovenian Autistic Children Elucidate the Comorbidity of Autism With Other Developmental Disorders. Front. Mol. Neurosci. 2022;15:912671. doi: 10.3389/fnmol.2022.912671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Lieberwirth J.K., Buttner B., Klockner C., Platzer K., Popp B., Abou Jamra R. AutoCaSc: Prioritizing candidate genes for neurodevelopmental disorders. Hum. Mutat. 2022;43:1795–1807. doi: 10.1002/humu.24451. [DOI] [PubMed] [Google Scholar]
- 66.Younis N.S., Mohamed M.E., Alolayan A.A., Alhussain G.Y., Al-Mousa H.A., Alshamrani J.A., AlMutayib M.M., AlQahtani M.M., Alhaddad Z.A., Alfarhan Z.S., et al. Identification of epilepsy concomitant candidate genes recognized in Saudi epileptic patients. Eur. Rev. Med. Pharmacol. Sci. 2022;26:2143–2157. doi: 10.26355/eurrev_202203_28362. [DOI] [PubMed] [Google Scholar]
- 67.Kamal N., Jafari Khamirani H., Dara M., Dianatpour M. NRXN3 mutations cause developmental delay, movement disorder, and behavioral problems: CRISPR edited cells based WES results. Gene. 2023;867:147347. doi: 10.1016/j.gene.2023.147347. [DOI] [PubMed] [Google Scholar]
- 68.Duong L., Klitten L.L., Moller R.S., Ingason A., Jakobsen K.D., Skjodt C., Didriksen M., Hjalgrim H., Werge T., Tommerup N. Mutations in NRXN1 in a family multiply affected with brain disorders: NRXN1 mutations and brain disorders. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2012;159:354–358. doi: 10.1002/ajmg.b.32036. [DOI] [PubMed] [Google Scholar]
- 69.Harrison V., Connell L., Hayesmoore J., McParland J., Pike M.G., Blair E. Compound heterozygous deletion of NRXN1 causing severe developmental delay with early onset epilepsy in two sisters. Am. J. Med. Genet. Part A. 2011;155:2826–2831. doi: 10.1002/ajmg.a.34255. [DOI] [PubMed] [Google Scholar]
- 70.Falivelli G., De Jaco A., Favaloro F.L., Kim H., Wilson J., Dubi N., Ellisman M.H., Abrahams B.S., Taylor P., Comoletti D. Inherited genetic variants in autism-related CNTNAP2 show perturbed trafficking and ATF6 activation. Hum. Mol. Genet. 2012;21:4761–4773. doi: 10.1093/hmg/dds320. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data presented in this study are available on request from the corresponding author. The data are not publicly available due to institutional guidelines.

