| Antibodies |
|
|
|
| Rabbit Anti-mouse CRAMP |
Nizet et al., 20214
|
N/A |
| Goat anti-rabbit IgG(Fab)2-AlexaFluor488 |
Invitrogen |
Cat#: A11070, Lot#: 1040038, RRID: AB_2532697 |
|
| Bacterial and virus strains |
|
|
|
|
Staphylococcus hominis A9 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis A9 ΔLanti |
Nakatsuji et al., 201728
|
N/A |
|
Staphylococcus epidermidis G9 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus epidermidis D1 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis C4 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis C5 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis PR-A3 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus epidermidis N009-G7 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus epidermidis A11 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis C2 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis AMT2-A12 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus hominis AMT4-D12 |
Nakatsuji et al., 201723
|
N/A |
|
Staphylococcus aureus ATCC35556 |
ATCC |
Cat#: ATCC35556 |
|
| Chemicals, peptides, and recombinant proteins |
|
|
|
| IMAGE-IT FX signal enhancer |
Invitrogen |
Cat#: I36933, Lot#: 2020111 |
| 5% Imiquimod cream |
Perrigo |
Cat#: NDC45802-368-00, Lot#: 129235 |
| Contril cream for Imiquimod |
VWR |
Cat#: 56614-414, Lot#: N/A |
| MC903 |
TOCRIS |
Cat#: 2700, Batch#: 6A/248251 |
| 0.1% Triamcinolone |
Perrigo |
Cat#: NDC45802-055-35 |
| Vaseline (vehicle control for triamcinolone) |
Uniliver |
Cat#: 67352423 |
| Hanks’ balanced salt solution |
Thermo Fisher Scientific |
Cat#: 14175095 |
| Abtibiotic-antimycotic cocktail |
Thermo Fisher Scientific |
Cat#: 15240062 |
| deoxyribonuclease I |
Millipore Sigma |
Cat#: 4716728001 |
| Liberase TL |
Millipore Sigma |
Cat#: 05401020001, Lot#: 56708200 |
| HEPES solution |
Thermo Fisher Scientific |
Cat#: 15630080 |
| Sodium pyruvate |
Thermo Fisher Scientific |
Cat#: 11360070 |
| collagenase type IV |
Millipore Sigma |
Cat#: 11088882001, Lot#: |
| RNA later |
Invitrogen |
Cat#: AM7021, Lot#: 01085002 |
| Fetab Bobine Serum |
GEMINI Bio Products |
Cat#: 900-108, Lot#: A08G001 |
| Ovalubumin |
MP Biomedicals |
Cat#: 950512, Lot#: 8711K |
| Tryptic soy broth |
Millipore Sigma |
Cat#: T8907-1KG, used multiple lots |
| Bacto agar |
BD |
Cat#: 214010, Lot#: 1229826, used multiple lots |
| Bair-Parker agar |
BD |
Cat#: 276840, Lot#: 1272665 |
| Egg yolk tellurite |
BD |
Cat#: 212357, Lot#: 2019838 |
| Mannitol salt agar |
BD |
Cat#: 211407, Lot#: 0315698 |
| Egg yolk emulsion |
HiMedia |
Cat#: FD045-100MLX1VL, Lot#: 0000530825, used multiple lots |
| RPMI media |
GIBCO |
Cat#: 11875-093, Lot#: 2436322 |
| TE buffer |
Invitrogen |
Cat#: 12090-015, Lot#: 1691859 |
| Tween 20 |
ThermoFisher |
Cat#: 28320, Lot#: VJ307818 |
| Triton X-100 |
ThermoFisher |
Cat#: 28314, Lot#: VJ308263 |
| LL-37 |
Genemed Synthesis, Inc. |
Custom Peptide |
| human beta-defensin 2 |
Peptide International |
Cat#: ODF-4338-s, Lot#: 671212 |
| human beta-defensin 3 |
Peptide International |
Cat#: PDF-4382-s, Lot#: 660912 |
| CRAMP (GLL-33) |
Genemed Synthesis, Inc. |
Custom Peptide |
| LongAmp Hot Start Taq 2X Master Mix |
New England BioLabs |
Cat#: M0533S |
| Agencourt AMPure XP beads |
Beckman Coulter |
Cat#: A63881 |
|
| Critical commercial assays |
|
|
|
| PureLink Microbiome DNA extraction kit |
Invitrogen |
Cat#: A29789, Lot# 2077129 |
| PureLink RNA extraction kit |
Invitrogen |
Cat#: 12183025, Lot#: 2346694 |
| MACS dead cell removal kit |
Miltenyi Biotec |
Cat#: 130-090-101, Lot#:5210411028 |
| PCR Barcoding Kit |
Oxford Nanopore Technologies |
Cat#: SQK- PBK004 |
| KAPA2G Robust HotStart ReadyMix PCR Kit |
KAPA Biosystems |
Cat#: KK5701 |
|
| Deposited data |
|
|
|
| Single Cell RNA-seq data |
This paper |
DDBJ sequence read archive (www.ddbj.nig.ac.jp), accession number: DRA015287 |
|
| Experimental models: Organisms/strains |
|
|
|
| Wild-type Balb/c mice |
Jackson Laboratory |
Also known as Balb/cj, Strain #:000651, RRID:IMSR_JAX:000651 |
|
Camp−/− Balb/c mice |
Nizet et al., 20014
|
N/A |
|
Flgft/ft Balb/c mice |
Gifted by Dr. Raif Geha (Nakatsuji et al., 201618) |
N/A |
|
Il4ra−/− Balb/c mice |
Jackson Laboratory |
Also known as BALB/c-Il4ratm1Sz/J, Strain #:003514, RRID:IMSR_JAX:003514 |
|
| Oligonucleotides |
|
|
|
| Primers for Il4 qPCR |
Integrated DNA technologies |
Mm.PT.58.7882098 |
| Primers for Il13 qPCR |
Integrated DNA technologies |
Mm.PT.58.31366752 |
| Primers for Il17a qPCR |
Integrated DNA technologies |
Mm.PT.58.6531092 |
| Primers for Tslp qPCR |
Integrated DNA technologies |
Mm.PT.58.41321689 |
| Primers/Probe for Camp qPCR |
Applied Biosystems |
Forward: CTTCACCAGCCCGTCCTTC, Reverse: CCAGGACGACACAGCAGTCA, Probe: FAM-CAGAGGATTGTGACTTCA-MGB |
| Primers for Defb4 qPCR |
Integrated DNA technologies |
Mm.PT.58.29993789 |
| Primers for Defb14 qPCR |
Integrated DNA technologies |
Mm.PT.58.41499310 |
| Primers/Probe for Gapdh qPCR |
Applied Biosystems |
Forward: CTTAGCACCCCTGGCCAAG, Reverse: TGGTCATGAGTCCTTCCACG, Probe: VIC-CATCCATGACAACTTTGGTA-MGB |
| Primers for ShA9-lantibiotic-alpha qPCR |
Integrated DNA technologies |
Forward: GAGGAGCTACACCGACTATTAC, Reverse: CACATCTAGAAGAGCAAGCTAATG |
|
| Software and algorithms |
|
|
|
| GraphPad Prism |
GraphPad |
Version 9.4.1 |
|
| Other |
|
|
|
| Swab |
Puritan |
25-1506 1PF BT BL |
| Tegaderm wound dressing film |
3M |
Cat#: 1620 |