Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Per-Cp-Cy5.5 anti-mouse TCR-beta (clone H57-597) | BioLegend | Cat# 109228; RRID: AB_1575173 |
| Per-Cp-Cy5.5 anti-mouse TCR-beta (clone H57-597) | BioLegend | Cat# 109228; RRID: AB_1575173 |
| FITC anti-mouse/human Helios (clone 22F6) | BioLegend | Cat# 137214; RRID: AB_10662745 |
| Pe-Cy7 anti-mouse CD8 (clone 53-6.7) | BD Biosciences | Cat# 552877; RRID: AB_394506 |
| APC-efluor 780 anti-mouse B220 (clone RA3-6B2) | Thermo Fisher Scientific | Cat# 47-0452-80; RRID: AB_1518811 |
| APC-efluor 780 anti-mouse CD11b (clone M1/70) | Thermo Fisher Scientific | Cat# 47-0112-82; RRID: AB_1603193 |
| APC-efluor 780 anti-mouse CD11c (clone N4818) | Thermo Fisher Scientific | Cat# 47-0114-82; RRID: AB_1548652 |
| APC-efluor 780 anti-mouse F4/80 (clone BM8) | Invitrogen | Cat# 47-4801-82; RRID: AB_2735036 |
| APC anti-mouse CD44 (clone IM7) | Thermo Fisher Scientific | Cat# 17-0441-82; RRID: AB_469390 |
| e450 anti-mouse Foxp3 (clone FJK-16S) | Thermo Fisher Scientific | Cat#48-5773-82; RRID: AB_1518812 |
| BV650 anti-mouse CD4 (clone RM4-5) | BD Biosciences | Cat#563747; RRID: AB_2716859 |
| PE/Cyanine7 anti-mouse IL-17A (clone TC11-18H10.1) | BioLegend | Cat# 506922; RRID:AB_2125010 |
| PE anti-mouse CD8a (clone 53-6.7) | Thermo Fisher Scientific | Cat# 56-0081-80; RRID:AB_494006 |
| BV480 Rat Anti-Mouse CD8a (Clone 53-6.7) | BD Biosciences | Cat# 566096; RRID:AB_2739500 |
| BV605 anti-mouse TCR-beta (clone H57-597) | BD Biosciences | Cat# 562840; RRID: AB_2687544 |
| BV711 anti-mouse CD3 (clone 145-2C11) | BD Biosciences | Cat#563123; RRID: AB_2687954 |
| PerCP/Cyanine5.5 anti-mouse CD301b (clone URA-1) | BioLegend | Cat# 146810; RRID:AB_2563392 |
| PE/Cyanine7 anti-mouse Ly-6G (clone 1A8) | BioLegend | Cat# 127618; RRID:AB_1877261 |
| PE anti-mouse/human CD11b (clone M1/70) | BioLegend | Cat# 101208; RRID:AB_312791 |
| APC anti-mouse CD103 (clone 2E7) | Thermo Fisher Scientific | Cat# 17-1031-82; RRID: AB_1106992 |
| e450 anti-mouse MHCII (clone M5/114.15.2) | Thermo Fisher Scientific | Cat#48-5321-82; RRID: AB_1272204 |
| BV605 anti-mouse Ly6C (clone HK1.4) | BioLegend | Cat#128035; RRID: RRID:AB_2562352 |
| Brilliant Violet 650™ anti-mouse CD326 (Ep-CAM) (clone G8.8) | BioLegend | Cat# 118241; RRID:AB_2876432 |
| BV786 anti-mouse CD64 (clone X54-5/7.1) | BD Biosciences | Cat#741024; RRID:AB_2740644 |
| FITC Rat Anti-Mouse CD25 (clone 7D4) | BD Biosciences | Cat# 553072; RRID:AB_394604 |
| PE-Cy™7 Mouse anti-Ki-67 (clone B56) | BD Biosciences | Cat# 561283; RRID:AB_10716060 |
| PE anti-mouse CD69 (clone H1.2F3) | BioLegend | Cat# 104507; RRID:AB_313110 |
| Alexa Fluor™ 700 anti-mouse CD3 (clone 17A2) | Thermo Fisher Scientific | Cat# 56-0032-82; RRID:AB_529507 |
| AlexaFluor700 anti-mouse CD45 (clone 30-F11) | Thermo Fisher Scientific | Cat# 56-0451-82; RRID:AB_891454 |
| APC anti-mouse FOXP3 (clone FJK-16s) | Thermo Fisher Scientific | Cat# 17-5773-82; RRID:AB_469457 |
| Brilliant Violet 785™ anti-mouse CD8a (clone 53-6.7) | BioLegend | Cat# 100749; RRID:AB_11218801 |
| PerCP/Cyanine5.5 anti-mouse TCR γ/δ (clone GL3) | BioLegend | Cat# 118118; RRID:AB_10612756 |
| BUV395 Rat Anti-Mouse I-A/I-E (Clone 2G9) | BD Biosciences | Cat# 743876; RRID:AB_2741827 |
| BUV496 Rat Anti-Mouse CD45 (clone 30-F11) | BD Biosciences | Cat# 749889; RRID:AB_2874129 |
| BUV805 Rat Anti-CD11b (Clone M1/70) | BD Biosciences | Cat# 741934; RRID:AB_2871246 |
| BV480 Hamster Anti-Mouse CD11c (clone N418) | BD Biosciences | Cat# 746392; RRID:AB_2743706 |
| Alexa Fluor® 594 anti-mouse CD103 (clone 2E7) | BioLegend | Cat# 121428; RRID:AB_2565571 |
| PE Rat Anti-Mouse CD40 (clone 3/23) | BD Biosciences | Cat# 561846; RRID:AB_10896482 |
| PE/Cyanine7 anti-mouse CD252 (OX40L) (clone RM134L) | BioLegend | Cat# 108813; RRID:AB_2565744 |
| BUV737 Rat Anti-Mouse CD274 (PDL-1) (clone MIH5) | BD Biosciences | Cat# 741877; RRID:AB_2871203 |
| APC Rat anti-Mouse CD273 (PDL-2) (clone TY25) | BD Biosciences | Cat# 560086; RRID:AB_1645223 |
| BV750 Rat Anti-Mouse CD86 (clone GL1) | BD Biosciences | Cat# 747439; RRID:AB_2872120 |
| BV421 Hamster Anti-Mouse CD80 (clone 16-10A1) | BD Biosciences | Cat# 562611; RRID:AB_2737675 |
| Brilliant Violet 605™ anti-mouse CD197 (CCR7) | BioLegend | Cat# 120125; RRID:AB_2715777 |
| PE-Cy7 anti-mouse CD11c (clone HL3) | BD Biosciences | Cat# 558079; RRID: AB_647251 |
| TotalSeq™-A0201 anti-mouse CD103 (clone 2E7) | BioLegend | Cat# 121437; RRID:AB_2750349 |
| TotalSeq™-A0014 anti-mouse/human CD11b (clone M1/70) | BioLegend | Cat# 101265; RRID:AB_2734152 |
| TotalSeq™-A0566 anti-mouse CD301b (MGL2) (clone URA-1) | BioLegend | Cat# 146817; RRID:AB_2783115 |
| PE/Cy7 Anti-human CD1c (clone: L161) | BioLegend | Cat# 331516;RRID:AB_2275574 |
| PerCP/Cyanine5.5 anti-human HLA-DR (Clone Tü36) | BioLegend | Cat# 361608; RRID:AB_2563198 |
| PE anti-human CD14 (clone M5E2) | BioLegend | Cat# 301806;RRID:AB_314188 |
| APC-eFluor™ 780 anti-human CD45 (clone HI30) | Thermo Fisher Scientific | Cat# 47-0459-42; RRID:AB_1944368 |
| A700 anti-human CD1a (clone H1149) | BioLegend | Cat# 300120;RRID:AB_528764 |
| APC anti-human CD141 (Clone BDCA-3) | Miltenyi Biotech | Cat# 130-113-314;RRID:AB_2733313 |
| BV605 anti-human CD11c (Clone B-Ly6) | BD Biosciences | Cat# 563929;RRID:AB_2744276 |
| BV421 anti-human CD16 (clone 3G8) | BioLegend | Cat# 302038;RRID:AB_2561578 |
| PE-conjugated 2w-loaded I-A(b) Tetramer | Provided by James Moon | |
| Staphylococcus epidermidis Tü3298 | Provided by Michael Otto (Augustin and Gotz, 1990) | |
| Staphylococcus lugdunensis Slug_2E06 | Provided by Julie Segre | |
| Staphylococcus hominis SK119 | BEI | |
| Staphylococcus capitis Scap_DM02D06 | Provided by Julie Segre | |
| Biological samples | ||
| Healthy baby Foreskin tissue | UCSF Benioff Children's Hospital San Francisco | |
| Chemicals, peptides, and recombinant proteins | ||
| PE-conjugated 2w-loaded I-A(b) Tetramer | Provided by James Moon | |
| Fetal bovine serum | Fisher scientific | Cat#SH3054103 |
| Fetal calf serum | Fisher scientific | Cat#SH3007303 |
| Tryptic Soy Medium | BD-Bacto | Cat#211825 |
| Collagenase from Clostridium histolyticum, Type XI | Sigma-Aldrich | Cat#C9407 |
| Collagenase from Clostridium histolyticum, Type I | Sigma-Aldrich | Cat#SCR103 |
| Collagenase from Clostridium histolyticum, Type IV | Sigma-Aldrich | Cat#lS00418 |
| Recombinant Human TGF-β1 | Peprotech Inc. | Cat# 100-21C-10UG |
| Recombinant Murine IL-2 | GoldBio | Cat#1310-02-100 |
| Collagenase D | Sigma-Aldrich | Cat#11088866001 |
| Diphtheria toxin | Sigma-Aldrich | Cat# D0564 |
| Cytochalasin D | Cayman Chemicals | Cat#11330 |
| Collagen I, rat tail | Thermo Fischer Scientific | Cat# A1048301 |
| DNase | Sigma-Aldrich | Cat#DN25 |
| Hyaluronidase from bovine testes | Sigma-Aldrich | Cat#H3506 |
| Critical commercial assays | ||
| Ghost Dye™ Violet 510 Live/Dead Stain | Tonbo Biosciences | Cat#13-0870-T100 |
| EasySep™ Mouse PE Positive Selection Kit | StemCell Technologies | Cat#18554 |
| CellTrace™ Violet Cell Proliferation Kit, for flow cytometry | Thermo Fischer Scientific | Cat# C34557 |
| ViaDye Red | Cytek | R7-60008 |
| Ghost Dye™ Violet 780 Live/Dead Stain | Tonbo Biosciences | Cat#13-0865-T100 |
| Allprep DNA/RNA micro kit | Qiagen | Cat# 80284 |
| SuperScript™ III First-Strand Synthesis System | Thermo Fischer Scientific | Cat# 18080051 |
| Buffer RLT Plus | Qiagen | Cat# 1053393 |
| Power SYBR Green PCR master mix | Thermo Fischer Scientific | Cat#4368577 |
| AldeRed® ALDH Detection Assay | Sigma-Aldrich | Cat#SCR150 |
| Mouse FoxP3 Buffer Set | eBiosciences | Cat#00-5523-00 |
| Deposited data | ||
| Mouse neonatal dendritic cells from uncolonized, and Staphylococcus epidermidis-zsgreen colonized mouse (loaded and non-loaded cells | This paper | GSE206891 |
| Skin and Skin Draining lymph node dendritic cells from neonatal mouse colonized with a commensal or control | This paper | GSE206892 |
| Neonatal foreskin antigen presenting cells after colonization with Staphylococcus epidermidis | This paper | GSE206893 |
| Adult mouse skin dendritic cells | This paper | GSE217891 |
| Experimental models: Cell lines | ||
| Experimental models: Organisms/strains | ||
| SPF C57BL/6J mice | Jackson Laboratory | Cat#000664 |
| Mgl2CreH2ab1fl/f | Provided by Y. Kumamoto | |
| Cd11cCre Aldh1a2fl/f | Provided by R. Noelle | |
| Xcr1DTR-Venus | Jackson Laboratory | Cat#5544058 |
| OT-II | Jackson Laboratory | Cat#004194 |
| HuLangDTR | Provided by D. Kaplan | |
| Mgl2DTR-eGFP | Provided by Y. Kumamoto | |
| Oligonucleotides | ||
| Aldh1a2 primer forward: 5’-GACTTGTAGCAGCTGTCTTCACT-3’ | ||
| Aldh1a2 primer reverse: 5’-TCACCCATTTCTCTCCCATTTCC-3’ | ||
| Rsp17 forward: ATTGAGGTGGATCCCGACAC | ||
| Rsp17 reverse: TGCCAACTGTAGGCTGAGTG | ||
| Recombinant DNA | ||
| ZsGreen optimized for expression in Staphylococcus to generate pJL74-2w-zsgreen | DNA 2.0/ATUM | Custom project |
| Software and algorithms | ||
| GraphPad Prism | GraphPad Software, Inc | http://www.graphpad.com/scientific-software/prism/ |
| FlowJo v10.5.0 | FlowJo, LLC | https://www.flowjo.com/solutions/flowjo |
| Seurat | Stuart T. et al. 2019 | |
| R Statistical Computing Software | The R Foundation | https://www.r-project.org/ |
| Other | ||
| World Precision Instrument Low Toxicity Silicone Adhesive, 2 5ml Syringes | Fischer scientific | 50-822-154 |