Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| MKT (Acaa2) | Millipore Sigma | WH0010449M1; RRID:AB_2219394 |
| CrAT | ABCAM | ab153750; RRID:AB_2935643 |
| SCHAD | ProteinTech | 19828–1AP; RRID:AB_10667408 |
| ATP5A | ABCAM | ab14748; RRID:AB_301447 |
| OxPHOS Cocktail | ab110413; RRID:AB_2629281 | |
| SDHA | ABCAM | ab14715; RRID:AB_301433 |
| NDUFA9 | ABCAM | ab14713; RRID:AB_301431 |
| T-AMPK | CST | 2532; RRID:AB_330331 |
| P-AMPK | CST | 2531; RRID:AB_330330 |
| HSP60 | CST | 12165; RRID:AB_2636980 |
| Chemicals, peptides, and recombinant proteins | ||
| MOPS Free Acid | Millipore Sigma | Cat# M1254 CAS# 1132–61-2 |
| MES Potassium Salt | Millipore Sigma | Cat# M0895 CAS# 39946–25-3 |
| Bovine Serum Albumin (Fatty Acid Free) | Millipore Sigma | Cat# A3803 CAS# 9048–46-6 |
| EDTA | Millipore Sigma | Cat# E0270 CAS# 65501–24-8 |
| Trypsin from Porcine Pancreas (Mitochondrial Isolation) | Millipore Sigma | Cat# T4799 CAS# 9001–51-8 |
| Potassium Chloride | Millipore Sigma | Cat# P5405 CAS# 7447–40-7 |
| Magnesium Sulfate | ||
| Magnesium Chloride Hexahydrate | Millipore Sigma | Cat# M2670 CAS# 7791–18-6 |
| EGTA | Millipore Sigma | Cat# E4378 CAS# 67–42-5 |
| Potassium Dihydrogen Phosphate | Millipore Sigma | Cat# P9791 CAS# 7778–77-0 |
| Creatine Monohydrate | Millipore Sigma | Cat# C3630 CAS# 6020–87-7 |
| Potassium Salt of Phosphocreatine | Millipore Sigma | |
| Palmitoyl-L-carnitine | Millipore Sigma | Cat# P1645 CAS# 18877–64-0 |
| Octanoyl-L-carnitine | Millipore Sigma | Cat# 50892 CAS# 25243–95-2 |
| L-Carnitine hydrochloride | ||
| Malic Acid (Malate) | Millipore Sigma | Cat# M1000 CAS# 97–67-6 |
| α-ketoglutaric acid (aKG) | MilliporeSigma | Cat# K1750 CAS# 328–50-7 |
| (R)-3-Hydroxybutyric acid | Millipore Sigma | Cat# 54920 CAS# 625–72-9 |
| Succinic Acid (Succinate) | Millipore Sigma | Cat# S3674 CAS# 110–15-6 |
| Potassium Pyruvate | Combi-Blocks | Cat# QA-1116 CAS# 4151–33-1 |
| Creatine Kinase from Rabbit Muscle | Roche | Cat# 10127566001 |
| Tetramethylrhodamine Methyl Ester (TMRM) | ThermoFisher | Cat# T668 |
| Rotenone | Millipore Sigma | Cat# R8875 CAS# 83–79-4 |
| Potassium Cyanide | Millipore Sigma | Cat# 60178 CAS# 151–50-8 |
| Alamethicin | AG Scientific | A-1286 CAS#27061–78-5 |
| Methanol | Millipore Sigma | Cat# 439193 CAS# 67–56-1 |
| Protease Inhibitor Cocktail | Millipore Sigma | Cat# P8340 |
| Phosphatase Inhibitor Cocktail 2 | Millipore Sigma | Cat# P5726 |
| Phosphatase Inhibitor Cocktail 3 | Millipore Sigma | Cat# P0044 |
| Pierce Reversible Protein Stain Kit for Nitrocellulose Membranes (Memcode) |
ThermoFisher Scientific |
Cat# 24580 |
| 4–15% Criterion TGX Stain-Free Protein Gel, 18well | Biorad | Cat# 5678084 |
| 10X Tris Glycine SDS Running Buffer | Biorad | Cat# 1610732 |
| 10X Tris Buffered Saline | Biorad | Cat# 1706435 |
| Fish Gelatin | Millipore Sigma | Cat# G7765 |
| Casein | Millipore Sigma | Cat# C0626 |
| Roche cOmplete ULTRA EDTA-free Protease Inhibitor Mini Tablet | Millipore Sigma | Cat# 05892791001 |
| Roche 1x PhosSTOP Phosphatase Inhibitor Cocktail Tablets | Millipore Sigma | Cat# 04906837001 |
| Lysyl Endopeptidase, Mass Spectrometry Grade | Wako Chemicals | Cat# 125–05061 |
| Sequencing Grade Modified Trypsin | Promega | Cat# V5113 |
| tC18 SEP-PAK Solid Phase Extraction Columns (50 mg) | Waters | Cat# WAT054960 |
| tC18 SEP-PAK Solid Phase Extraction Columns (100 mg) | Waters | Cat# WAT036820 |
| Triethylammonium bicarbonate (TEAB) | ThermoFisher | Cat# 90114 |
| TRIzol Reagent | ThermoFisher | Cat# 15596026 |
| Chloroform | Millipore Sigma | Cat# C2432 CAS# 67–66-3 |
| [U-13C]-Glucose | ||
| [U-13C]-Pyruvate | ||
| CelLyticmtCelLytic™ MT Cell Lysis Reagent | SigmaAldrich | C3228 |
| Pentobarbital (Nembutal) | Oak Pharmaceuticals | |
| Critical commercial assays | ||
| Pierce BCA Protein Assay | ThermoFisher | Cat# 23225 |
| RNeasy mini spin columns | Qiagen | Cat# 74004 |
| iScript cDNA Synthesis Kit | BioRad | Cat# 170–8891 |
| PrimeTime Gene Expression Master Mix | IDT | Cat# 1055770 |
| TaqMan Gene Expression Assay Acaa2 | ThermoFisher | Mm00624282 |
| Lipofectamine RNAiMAX | ThermoFisher | 13778 |
| XF Plasma Membrane Permeabilizer | Agilent Technologies | 102504–100 |
| Deposited data | ||
| Proteomics Raw Data Files | This Publication | PXD040326; JPST002051 |
| Proteomics Raw Data Files | https://pubmed.ncbi.nlm.nih.gov/32660330/ | Experiment 3; Supplemental data; Protein SUMMARY_Exp3 Tab |
| Data S4 (Excel File) | This Publication | |
| Experimental models: Organisms/strains | ||
| C57BL/6NJ mice | The Jackson Laboratory | Stock #005304 |
| MCK-Pgc1a C57BL/6-Tg(Ckm-Ppargc1a)31Brsp/J | Dr. Bruce Speigelman | https://pubmed.ncbi.nlm.nih.gov/12181572 |
| MCK-CrAT C57BL/6J | Dr. Randall Mynatt (Pennington Biomedical Research Center) | https://pubmed.ncbi.nlm.nih.gov/22560225/ |
| Oligonucleotides | ||
| ACAA2/MKT siRNA | IDT | hs.Ri.ACAA2 - 13.1, 13.2, 13.3 |
| Non-targeting control sequence | IDT | 51–01-14–03 |
| Software and algorithms | ||
| Proteome Discoverer 2.2 | ThermoFisher | RRID:SCR_014477 |
| DatLab 7 | Oroboros Instruments | Product# 20700 |
| Other | ||
| Oxygraph-2k | Oroboros Instruments | Product# O2k-Core |
| QuantaMaster Spectrofluorometer | Horiba Scientific | Cat# QM-400 |
| Spectrosil Quartz Cuvettes | Starna | 23–5.45-Q-5 |
| Spectromax M2E Spectrophotometer | Molecular Devices | Part#: M2E |
| Thermo Fisher Scientific Q Exactive Plus Orbitrap Mass Spectrometer | ThermoScientific | Cat#: 0726030 |
| Thermo Fisher Scientific nanoEASY nLC | ThermoScientific | Cat #: LC140 |
| Waters Xevo TQ-S triple quadrupole mass spectrometer coupled to a Waters Acquity UPLC system | Waters | Part#: Xevo TQ-S |
| Bio-Rad Turboblot Transfer System | Biorad | Cat# 1704150EDU |
| TissueLyser II | Qiagen | Cat# 85300 |
| NanoDrop 8000 | ThermoScientific | ND-8000-GL |
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This paper | N/A |
| Bacterial and virus strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al.1 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al.2) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC 700294 | |
| Biological samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children’s Oncology Group Cell Culture and Xenograft Repository |
http://cogcell.org/ |
| Chemicals, peptides, and recombinant proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350–13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433–59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 12487–8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14–486 |
| GST-BMAL1 | Novus | Cat#H00000406P01 |
| Critical commercial assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | PerkinElmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202–1012 |
| Deposited data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/gen ome/assembly/grc/h uman/ |
| Nanog STILT inference | This paper; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This paper; Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental models: Cell lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09–0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental models: Organisms/strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy18(e364) III; unc-46(e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and NuessleinVolhard3 | ZFIN: ZDB-GENO060207–1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al.4 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This paper | N/A |
| Primers for XX, see Table SX | This paper | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This paper | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT |
Gene Tools | ZFIN: ZDB-MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAG GGUUCUCUCUAGGGA | This paper | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This paper | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl0130415 |
| AAV2/1-hsyn-GCaMP6-WPRE | Chen et al.5 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al.6 | Addgene Plasmid #21339 |
| Software and algorithms | ||
| ImageJ | Schneider et al.7 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg8 | http://bowtiebio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al.9 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al.10 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This paper; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal | This paper | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This paper | https://github.com/chrisamiller/aml31SuppSite |
| Chemicals, peptides, and recombinant proteins | ||
| QD605 streptavidin conjugated quantum dot | Thermo Fisher Scientific | Cat#Q10101MP |
| Platinum black | Sigma-Aldrich | Cat#205915 |
| Sodium formate BioUltra, ≥99.0% (NT) | Sigma-Aldrich | Cat#71359 |
| Chloramphenicol | Sigma-Aldrich | Cat#C0378 |
| Carbon dioxide (13C, 99%) (<2% 18O) | Cambridge Isotope Laboratories | CLM-185–5 |
| Poly(vinylidene fluoride-co-hexafluoropropylene) | Sigma-Aldrich | 427179 |
| PTFE Hydrophilic Membrane Filters, 0.22 μm, 90 mm | Scientificfilters.com/TischScientific | SF13842 |
| Critical commercial assays | ||
| Folic Acid (FA) ELISA kit | Alpha Diagnostic International | Cat# 0365–0B9 |
| TMT10plex Isobaric Label Reagent Set | Thermo Fisher | A37725 |
| Surface Plasmon Resonance CM5 kit | GE Healthcare | Cat#29104988 |
| NanoBRET Target Engagement K-5 kit | Promega | Cat#N2500 |
| Deposited data | ||
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Structure of compound 5 | This paper; Cambridge Crystallographic Data Center | CCDC: 2016466 |
| Code for constraints-based modeling and analysis of autotrophic E. coli | This paper | https://gitlab.com/elad.noor/sloppy/tree/master/rubisco |
| Software and algorithms | ||
| Gaussian09 | Frish et al.1 | https://gaussian.com |
| Python version 2.7 | Python Software Foundation | https://www.python.org |
| ChemDraw Professional 18.0 | PerkinElmer | https://www.perkinelmer.com/category/chemdraw |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al.2 | https://github.com/ChristophRau/wMICA |
| Other | ||
| DASGIP MX4/4 Gas Mixing Module for 4 Vessels with a Mass Flow Controller | Eppendorf | Cat#76DGMX44 |
| Agilent 1200 series HPLC | Agilent Technologies | https://www.agilent.com/en/products/liquid-chromatography |
| PHI Quantera II XPS | ULVAC-PHI, Inc. | https://www.ulvacphi.com/en/products/xps/phi-quantera-ii/ |