KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal anti-ERG (EPR3864) | Abcam, Cambridge, UK | Cat#ab92513; RRID: AB_2630401 |
| Rabbit polyclonal anti-FLI1 | Abcam, Cambridge, UK | Cat#ab15289; RRID: AB_301825 |
| Rabbit polyclonal anti-H3K27ac | Abcam, Cambridge, UK | Cat#ab4729; RRID: AB_2118291 |
| Rabbit polyclonal anti-H3K27me3 | Diagenode, Seraing, Belgium | Cat#C15410069; RRID: AB_2814977 |
| Rabbit polyclonal anti-H3K4me3 | Diagenode, Seraing, Belgium | Cat#C15410003; RRID: AB_2616052 |
| Horse polyclonal anti-mouse/rabbit IgG (Vectastain Elite ABC HRP Kit) | Vector Laboratories, Burlingame, CA, USA | Cat#PK-6200; RRID: AB_2336826 |
| Mouse monoclonal anti-PAX7 | DSHB, Iowa City, IA, USA | Cat#PAX7-c; RRID: AB_2299243 |
| Rabbit monoclonal anti-pMYBL2 (phospho T487; EPR2204Y) |
Abcam, Cambridge, UK | Cat#ab76009; RRID: AB_1309969 |
| Horse polyclonal anti-rabbit IgG (ImmPress HRP Polymer Detection Kit) |
Vector Laboratories, Burlingame, CA, USA | Cat#MP-7401; RRID: AB_2336529 |
| Rabbit polyclonal anti-SOX6 | Atlas Antibodies, Stockholm, Sweden | Cat#HPA003908; RRID: AB_1080063 |
| Mouse monoclonal anti-GAPDH (6C4) | Santa Cruz Biotechnology, Dallas, TX, USA | Cat#sc-32233; RRID: AB_627679 |
| Mouse monoclonal anti-FLI1 (MRQ-1) | Cell Marque, Rocklin, USA | Cat#254M; RRID: AB_1516868 |
| Goat polyclonal anti-mouse IgG (H + L), HRP |
Promega, Maddison, WI, USA | Cat#W402B; RRID: AB_430834 |
| Goat polyclonal anti-rabbit IgG (H + L) HRP | OriGene Technologies, Rockville, MD, USA | Cat#R1364HRP; RRID: AB_10262463 |
| Rabbit monoclonal anti-ERG (EP111) | Cell Marque, Rocklin, USA | Cat#434R |
| Bacterial and virus strains | ||
| Stellar Competent Cells | Clontech, TaKaRa, Saint-Germain-en-Laye, France | Cat#636763 |
| Biological samples | ||
| TMA of in vivo expanded EwS cell lines | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Doxycycline (dox) for in vivo experiments | belapharm, Vechta, Germany | Beladox |
| Doxycycline (dox) | Merck, Darmstadt, Germany | Cat#324385 |
| Lipofectamine RNAiMax | Thermo Fisher, Waltham, MA, USA | Cat#13778030 |
| Critical commercial assays | ||
| High-Capacity cDNA Reverse Transcription Kit |
Thermo Fisher, Waltham, MA, USA | Cat#4368814 |
| NucleoSpin RNA kit | Macherey-Nagel, Düren, Germany | Cat#740955 |
| SYBR SELECT Master Mix | Thermo Fisher, Waltham, MA, USA | Cat#4472908 |
| iDeal ChIP-seq kit for Transcription Factors | Diagenode, Seraing, Belgium | Cat#C01010170 |
| NucleoSpin Tissue genomic DNA prep kit | Macherey-Nagel, Düren, Germany | Cat#740952 |
| PureYield Plasmid Midiprep System | Promega, Maddison, WI, USA | Cat#A2492 |
| Deposited data | ||
| WGS data from 18 EwS cell lines; raw data | This paper | SRA: PRJNA610192 |
| Transcriptome data (DNA microarrays) from 18 EwS cell lines in EWSR1-ETS-high and -low condition; raw and processed data |
This paper | GEO: GSE176339 |
| DNA methylation data from 18 EwS cell lines in EWSR1-ETS-high and -low condition; raw data | This paper | GEO: GSE176339 |
| Proteomics data from mass spectometry of 18 EwS cell lines in EWSR1-ETS-high and -low condition; processed data |
This paper | Table S4A |
| ChIP-Seq data for 18 EwS cell lines (targets: FLI1, ERG, H3K27ac, H3K27me3, H3K4me3); raw and processed (BW) data |
This paper | GEO: GSE176339 |
| ChIP-Seq data for A-673 and SK-N-MC from Riggi et al. 2014 | GEO | GEO: GSE61953; https://doi.org/10.1016/j.ccell.2014.10.004 |
| Transcriptome data (DNA microarrays) from A-673 cells with E2F2 and GATA2 knockdown; raw and processed data | This paper | GEO: GSE212063 |
| Survival cohort, 196 primary EwS with clinical annotation and gene expression microarray data | lab of T.G.P. Grünewald | GEO: GSE12102, GSE17618, GSE34620, GSE63157; Javier Alonso, Unidad hemato-oncología pediátrica, Hospital Infantil Universitario La Paz, 28029 Madrid, Spain |
| Experimental models: Cell lines | ||
| Ewing sarcoma cell line A-673 | ATCC, Manassas, VA, USA | RRID: CVCL_0080 |
| Ewing sarcoma cell line CHLA-10 | Children’s Oncology Group, Monrovia, CA, USA | RRID: CVCL_6583 |
| Ewing sarcoma cell line CHLA-25 | Children’s Oncology Group, Monrovia, CA, USA | RRID: CVCL_M152 |
| Ewing sarcoma cell line EW-1 | Delattre, O., Paris, France | RRID: CVCL_1208 |
| Ewing sarcoma cell line EW-22 | Delattre, O., Paris, France | RRID: CVCL_1214 |
| Ewing sarcoma cell line EW-24 | Delattre, O., Paris, France | RRID: CVCL_1215 |
| Ewing sarcoma cell line EW-3 | Delattre, O., Paris, France | RRID: CVCL_1216 |
| Ewing sarcoma cell line EW-7 | Delattre, O., Paris, France | RRID: CVCL_1217 |
| Ewing sarcoma cell line MHH-ES-1 | DSMZ, Braunschweig, Germany | RRID: CVCL_1411 |
| Ewing sarcoma cell line MIC | Delattre, O., Paris, France | RRID: CVCL_EI96 |
| Ewing sarcoma cell line POE | Delattre, O., Paris, France | RRID: CVCL_EJ01 |
| Ewing sarcoma cell line RD-ES | DSMZ, Braunschweig, Germany | RRID: CVCL_2169 |
| Ewing sarcoma cell line Rh1 | Delattre, O., Paris, France | RRID: CVCL_1658 |
| Ewing sarcoma cell line SK-ES-1 | DSMZ, Braunschweig, Germany | RRID: CVCL_0627 |
| Ewing sarcoma cell line SK-N-MC | DSMZ, Braunschweig, Germany | RRID: CVCL_0530 |
| Ewing sarcoma cell line TC-106 | Children’s Oncology Group, Monrovia, CA, USA | RRID: CVCL_F531 |
| Ewing sarcoma cell line TC-32 | Children’s Oncology Group, Monrovia, CA, USA | RRID: CVCL_7151 |
| Ewing sarcoma cell line TC-71 | DSMZ, Braunschweig, Germany | RRID: CVCL_2213 |
| Human HEK293T | DSMZ, Braunschweig, Germany | RRID: CVCL_0063 |
| Experimental models: Organisms/strains | ||
| Mouse: NOD/Scid/gamma mice | Charles River, Wilmington, USA | RRID: IMSR_ARC:NSG |
| Oligonucleotides | ||
| shRNA targeting EWSR1-FLI1 type 1: 5’- GCAGCAGAACCCTTCTTATGA -3’ | eurofins Genomics, Ebersberg, Germany | first described in https://doi.org/10.1158/1078-0432.CCR-06-1762 |
| shRNA targeting EWSR1-FLI1 type 2: 5’- CTTTGGAGCCGCATCACAATA -3’ | eurofins Genomics, Ebersberg, Germany | N/A |
| shRNA targeting EWSR1-ERG: 5’- GCTACGGGCAGCAGAATTTAC -3’ | eurofins Genomics, Ebersberg, Germany | N/A |
| siPOOL against GATA2 | siTOOLs Biotech, Planegg, Germany | N/A |
| siPOOL against E2F2 | siTOOLs Biotech, Planegg, Germany | N/A |
| Primers | This paper | see Table S6 |
| Recombinant DNA | ||
| lentiviral pLKO-Tet-On all-in-one vector | Addgene, Watertown, USA52 | Cat#21915 |
| Software and Algorithms | ||
| Burrows-Wheeler Aligner | Li84 | https://bio-bwa.sourceforge.net |
| Picard | Broad Institute, Cambridge, MA, USA | https://broadinstitute.github.io/picard/ |
| GATK | Broad Institute, Cambridge, MA, USA | https://gatk.broadinstitute.org/hc/en-us |
| FASTQC | Andrews85 | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| Samtools | Li et al.86 | http://www.htslib.org |
| HOMER | Heinz et al.74 | http://homer.ucsd.edu |
| HipSTR | Willems et al.32 | https://hipstr-tool.github.io/HipSTR/ |
| Tandem Repeats Finder | Benson76 | https://github.com/Benson-Genomics-Lab/TRF |
| CNVnator | Benson76 | https://github.com/abyzovlab/CNVnator |
| CNVkit | Talevich et al.87 | https://cnvkit.readthedocs.io/en/stable/ |
| Bcftools | Li88 | https://samtools.github.io/bcftools/bcftools.html |
| SnpEff | Cingolani et al.89 | http://pcingola.github.io/SnpEff/ |
| LUMPY | Layer et al.90 | https://github.com/arq5x/lumpy-sv |
| GRIDSS | Cameron et al.91 | https://github.com/PapenfussLab/gridss |
| BreakDancer | Chen et al.26 | https://github.com/genome/breakdancer |
| ChainFinder | Baca et al.92 | https://software.broadinstitute.org/cancer/cga/chainfinder |
| bowtie2 | Langmead and Salzberg93 | https://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| MACS2 | Zhang et al.94 | https://hbctraining.github.io/Intro-to-ChIPseq/lessons/05_peak_calling_macs.html |
| IGV | Thorvaldsdóttir et al.95 | https://software.broadinstitute.org/software/igv/ |
| CHIPIN | Polit et al.96 | https://github.com/BoevaLab/CHIPIN |
| BEDTools | Quinlan and Hall97 | https://bedtools.readthedocs.io/en/latest/ |
| Transcriptome Analysis Console (4.0) | Thermo Fisher, Waltham, MA, USA | https://www.thermofisher.com/de/en/home/life-science/microarray-analysis/microarray-analysis-instruments-software-services/microarray-analysis-software/affymetrix-transcriptome-analysis-console-software.html |
| fancyimpute (v. 0.5.4., IterativeSVD) | Alex Rubinsteyn and Sergey Feldman: https://github.com/iskandr/fancyimpute |
https://pypi.org/project/fancyimpute/ |
| GenomeStudio | Illumina, San Diego, CA, USA | https://emea.illumina.com/techniques/microarrays/array-data-analysis-experimental-design/genomestudio.html |
| R minfi package | Aryeeet al.98 | https://bioconductor.org/packages/release/bioc/html/minfi.html |
| Gene Set Enrichment Analysis | Subramanian et al.99 | https://www.gsea-msigdb.org/gsea/index.jsp |
| MolecularNeuropathology.org | Capper et al.100 | https://www.molecularneuropathology.org/mnp/ |
| Weighted Correlation Network Analysis R package | Langfelder and Horvath101 | https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-9-559 |
| GraphPad PRISM (version 8) | GraphPad Software Inc., CA, USA | https://www.graphpad.com/scientific-software/prism/ |
| Circos plots | Krzywinski et al.102 | http://circos.ca |
| Other | ||
| Resources website for exploration of the ESCLA, R2 ESCLA | This paper | http://r2platform.com/escla/ |