|
Experimental Models
|
|
Escherichia coli BL21(DE3) gold |
Agilent Technology |
Cat. 230132 |
|
Escherichia coli OmniMAX |
ThermoFisher |
Cat. C854003 |
|
Escherichia coli SS320 |
Lucigen |
Cat. 60512‐1 |
| M13KO5 helper phage |
ThermoFisher |
Cat. 18311019 |
| Flp‐In T‐RExHeLa cells |
Stephen Taylor |
|
|
Recombinant DNA
|
| pETM33 |
EMBL |
|
| pETM41 |
EMBL |
|
| Phagemid p8 |
Sidhu lab (PMID: 25879139) |
|
| HURP cDNA |
CPR clone resource |
|
| YFP pcDNA/FRT/TO |
Nilsson lab – cloning YFP with HindIII in pcDNA5/FRT/TO |
|
|
Antibodies
|
| HRP‐conjugated anti‐M13 bacteriophage monoclonal mouse antibody |
Sino Biological Inc |
Cat. 11973‐MM05T‐H/RRID: AB_2857928 |
| anti‐CHC polyclonal rabbit antibody |
Bethyl Laboratories |
Cat. A304‐743A‐M/RRID: AB_2782136 |
| anti‐HURP polyclonal rabbit antibody |
Bethyl Laboratories |
Cat. A300‐852‐M/RRID: AB_2779502 |
| anti‐GFP (mouse/rabbit) antibody |
rabbit‐ anti GFP, produced in‐house or mouse anti‐GFP from Roche |
Cat. 11814460001/RRID: AB_390913 for Roche |
| IRDye® 800CW Goat anti‐Mouse IgG Secondary Antibody |
LI‐COR |
Cat. 926‐32210/RRID: AB_621842 |
| IRDye® 680RD Goat anti‐Rabbit IgG Secondary Antibody |
LI‐COR |
Cat. 926‐68071/RRID:vAB_10956166 |
|
Oligonucleotides and sequence‐based reagents
|
| RNA oligos/Ambion™ Silencer™ Select Pre‐Designed siRNA |
Thermo Fisher |
s18913 |
| Oligonucleotides PM_HD2 |
CustomArrray |
|
| HURP_fwd_in_YFP |
GATCGGATCCATGTCTTCATCACATTTTGCC |
|
| HURP_rev_in_YFP_wt |
GATCGCGGCCGCTCAAAATTCTCCTGGTTGTAGAGG |
|
| HURP_rev_in_YFP_delta835‐846 |
GATCGCGGCCGCTCAGTTACCACCAAAAGAAATGTGTC |
|
| HURP_fwd_S839A |
GGTAACCTGATTACTTTTGCACCTCTACAACCAGGAG |
|
| HURP_rev_S839A |
CTCCTGGTTGTAGAGGTGCAAAAGTAATCAGGTTACC |
|
| SiRes_HURP_fwd_483 |
GATAACGAGAGTGACGTGAGGGCGATCCGACCTGGTCC |
|
| SiRes_HURP_rev_483 |
GGACCAGGTCGGATCGCCCTCACGTCACTCTCGTTATC |
|
| SiRes_HURP_fwd_484 |
ATGCCGGTCCTCAAAACACAAAGAGTGAACATGTGAAG |
|
| Sires_HURP_rev_484 |
CTTCACATGTTCACTCTTTGTGTTTTGAGGACCGGCAT |
|
|
Chemicals, enzymes and other reagents
|
| Zeocin |
Invitrogen |
Cat. R25001
|
| Blasticidin |
Invitrogen |
Cat. R21001
|
| Doxycyclin |
Clontech Labs |
631311 – 5g |
| Nocodazole |
Sigma |
Cat. M1404 |
| Lipofectamine™ RNAiMAX Transfection Reagent |
Invitrogen |
Cat. 13778‐150 |
| Hygromycin B |
Invitrogen |
Cat. 10687010 |
| 0.25 % Trypsin/EDTA |
ThermoFisher |
Cat. 25200‐056 |
| DMEM GlutaMax 4.5 g/l D‐Glucose, Pyruvate |
Thermo Fisher |
Cat. 31966047 |
| OPTIMEM medium |
Invitrogen |
Cat. 51985026 |
| GFP‐Trap Agarose |
YChromotek |
Cat. GTA‐20 |
| PhosSTOP Easypack |
Roche |
Cat. 04906837001 |
| Thymidine |
Sigma |
Cat. T1895 |
| IGEPAL CA‐630 |
Sigma |
Cat. I8896 |
| Protein Assay Dye Reagent Concentrate |
Bio‐Rad |
Cat. 5000006 |
| NuPAGE LDS Sample buffer (4×) |
Novex |
Cat. NP0008 |
| MOPS SDS Running Buffer (20×) |
Invitrogen |
Cat. NP0001‐02 |
| cOmplete™ EDTA‐free Protease Inhibitor Cocktail |
Roche |
Cat. 4693132001 |
| T4 polynucleotide kinase |
Thermo Scientific |
Cat. EK0031 |
| T7 DNA polymerase |
Thermo Scientific |
Cat. EP0081 |
| T4 DNA ligase |
Thermo Scientific |
Cat. EL0014 |
| 50 bp marker |
Thermo Scientific |
Cat. 10416014 |
| Mag‐bind Total Pure NGS |
Omega Bio‐tek |
Cat. M1378‐01 |
| QIAquick Gel extraction Kit |
Qiagen |
Cat. 28706X4 |
| Quant‐iT PicoGreen dsDNA Assay Kit |
Molecular probes by Life technologies |
Cat. P7589 |
| TMB substrate |
Seracare KPL |
Cat. 5120‐0047 |
| QIAquick Nucleotide Removal Kit |
Qiagen |
Cat. 28306 |
| GSH Sepharose 4 Fast Flow Media |
Cytiva |
Cat. 17513201 |
| Ni Sepharose excel |
Cytiva |
Cat. 17371201 |
| FastDigest SmaI |
ThermoFisher |
Cat. FD0663 |
| Affinity chromatography columns, HiTrap™ Benzamidine FF |
Cytiva |
Cat. 17514302 |
| Thrombin |
Cytiva |
Cat. 27‐0846‐01 |
| Thermo Scientific™ Lysozyme |
ThermoFisher |
Cat. 89833 |
| GelRed |
Biotium |
Cat. 41003‐T |
| Thermo Scientific™ Phusion High‐Fidelity PCR Master Mix with HF Buffer |
ThermoFisher |
Cat. F631L |
| QIAquick PCR Purification Kit |
Qiagen |
Cat. 28104 |
| jetOPTIMUS® DNA transfection reagant and buffer |
Polyplus |
Cat. 101000006 |
| 96‐well Flat‐bottom Immunosorp MaxiSorp plates |
Nunc, Roskilde, Denmark |
Cat. 439454 |
| 384‐well Flat‐bottom Immunosorp MaxiSorp plates |
Nunc, Roskilde, Denmark |
Cat. 464718 |
| 96‐well half area black Flat‐bottom Nonbinding surface plates |
Corning, USA |
Cat. 3993 |
| 100 × 20 cm Greiner Cellstar Cell Culture Dish |
Greiner Bio‐One |
Cat. 664160 |
| 145 × 20 cm Greiner Cellstar Cell Culture Dish |
Greiner Bio‐One |
Cat. 639160 |
| μ‐slide 8 well |
Ibidi |
Cat. 80826 |
|
Software
|
| GraphPad Prism version 9.3.1 for MacOS |
GraphPad Software, San Diego, CA, USA, www.graphpad.com
|
| ImageJ |
https://imagej.nih.gov/ij/
|
| PyMOL Version 2.1.1 |
New York, NY, USA Schrodinger LLC |
| DeltaVision Softworx Software |
DeltaVision |
|
| Python version 3 |
Van Rossum and Drake (2009) |
|
| Pandas |
McKinney (2010) |
|
| Matplotlib |
Hunter (2007) |
|
| Seaborn |
Waskom et al (2021) |
|
| Inkscape |
Inkscape Project (2020). Inkscape. Retrieved from https://inkscape.org
|
|
|
Other
|
| iD5 |
Molecular Devices |
|
| iTC200 |
Malvern |
|
| PCR machine |
Biometra TGradient |
|
| Illumina MiSeq v3 run, 1 × 150 bp read setup, 20% PhiX |
NGS‐NGI SciLifeLab facility |
|
| Nanodrop ND‐1000 |
Thermo Fisher |
|
| DeltaVision Microscope |
DeltaVision |
|