Table 1.
Comparative mitochondrial qPCR analysis of EP155 and EP155/CHV1-EP713.
| Gene ID* | Primers | Primers' position in mitochondrial assembly | Amplification product length | Amplification ratio. EP155/CHV1-EP713/EP155 | Reference gene |
|---|---|---|---|---|---|
| Mit 1 | 5′AGGTGTTCTAAATTTACCATGC3′ | Crypa2|mitochondria.fasta:294-315 | 135 bp | 5.8 | Cox4 |
| 5′GCTTTTATCCAGTCTGAATT3′ | Crypa2|mitochondria.fasta:409-428 | ||||
| Mit 2 | 5′ATAATAATGCAACCTTTGGG3′ | Crypa2|mitochondria.fasta:13757-13776 | 130 bp | 5.0 | Cox4 |
| 5′GACCACATTGGGAATGAAAA3′ | Crypa2|mitochondria.fasta:13867-13886 | ||||
| Mit 3 | 5′TCCCCGTCTACTACTTGATA3′ | Crypa2|mitochondria.fasta:20729-20748 | 144 bp | 4.3 | Cox4 |
| 5′CTTGCAGATAATAAAGGACA3′ | Crypa2|mitochondria.fasta:20853-20872 |
*Mitochondrial genome sequence was from C. parasitica database v2.0 mitochondrial assembly.