Skip to main content
. 2023 Jul 3;12:e85748. doi: 10.7554/eLife.85748

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (C. elegans) lgg-1 Wormbase WBGene00002980
Strain, strain background (C. elegans) N2 CGC Wild-type strain
Genetic reagent (C. elegans) DA2123 CGC adIs2122[gfp::lgg‐1;rol‐6(su1006)]
Genetic reagent (C. elegans) GK1057 Sato and Sato, 2011 Pspe‐11‐hsp‐6::GFP
Genetic reagent (C. elegans) HZ455 CGC him‐5(e1490) V; bpIs131[sepa‐1::gfp]
Genetic reagent (C. elegans) HZ1685 CGC atg‐4.1(bp501)
Genetic reagent (C. elegans) MAH247 CGC sqls25[atg‐18 p::atg‐18::gfp +rol‐6(su1006) ]
Genetic reagent (C. elegans) RD202 Legouis lab Is202[unc‐119(ed3)III;plgg‐1::GFP::LGG‐1 G‐>A]
Genetic reagent (C. elegans) lgg-1(Δ) Mitani lab NBRP: tm3489 lgg‐1(tm3489)
Genetic reagent (C. elegans) lgg-2(tm5755) Mitani lab NBRP: tm5755 lgg‐2(tm5755)
Genetic reagent (C. elegans) RD363; lgg-1(Δ112–123) This paper lgg‐1(pp22)dpy‐10(pp157) Legouis lab
Genetic reagent (C. elegans) RD367; lgg-1(G116A) This paper lgg‐1(pp65[G116A]) Legouis lab
Genetic reagent (C. elegans) RD368; lgg-1(Δ100–123) This paper lgg‐1(pp66) Legouis lab
Genetic reagent (C. elegans) RD420; lgg-1(G116AG117*) This paper lgg‐1(pp141[G116AG117stop]) Legouis lab
Genetic reagent (C. elegans) RD421; lgg-1(G116AG117A) This paper dpy-10(pp163)lgg-1(pp142[G116AG117A]) Legouis lab
Genetic reagent (C. elegans) RD425 This paper dpy-10(pp163)lgg1(pp142)/+;
SEPA-1::gfp
Legouis lab
Genetic reagent (C. elegans) RD435 This paper lgg‐1(pp141[G116AG117stop]);
atg‐18 p::atg‐18::gfp +rol‐6(su1006)
Legouis lab
Genetic reagent (C. elegans) RD436 This paper lgg‐1(pp65[G116A]); atg‐18 p::
atg‐18::gfp +rol‐6(su1006)
Legouis lab
Genetic reagent (C. elegans) RD440 This paper lgg‐1(pp141[G116AG117stop]);
lgg‐2(tm5755
) Legouis lab
Genetic reagent (C. elegans) RD446 This paper lgg‐1(pp65[G116A]);
lgg‐2(tm5755
) Legouis lab
Genetic reagent (C. elegans) RD447 This paper lgg‐1(tm3489); atg‐18 p::atg‐
18::gfp +rol‐6(su1006)
Legouis lab
Genetic reagent (C. elegans) RD448 This paper lgg‐1(pp65[G116A]);
SEPA‐1::gfp
Legouis lab
Genetic reagent (C. elegans) RD449 This paper lgg‐1(pp141[G116AG117stop]);
SEPA‐1::gfp
Legouis lab
Genetic reagent (C. elegans) RD450 This paper lgg‐1(tm3489)II; SEPA‐1::gfp Legouis lab
Strain, strain background (S. cerevisiae) BY4742 Euroscarf Mat alpha ura3Δ0, his3Δ1, leu2Δ0, lys2Δ0
Genetic reagent (S. cerevisiae) OC513 YKO collection BY4742, atg1::KanMX4
Genetic reagent (S. cerevisiae) OC612 YKO collection BY4742, atg8::KanMX4
Genetic reagent (S. cerevisiae) OC608‐OC609 This paper BY4742, atg8G116A Legouis lab
Genetic reagent (S. cerevisiae) OC610‐OC611 This paper BY4742, atg8G116A‐R117* Legouis lab
Genetic reagent (S. cerevisiae) OC613 This paper BY4742, pho8::pho8Δ60‐URA3KL Legouis lab
Genetic reagent (S. cerevisiae) OC614 This paper BY4742, atg1::KanMX4, pho8::
pho8Δ60‐URA3KL
Legouis lab
Genetic reagent (S. cerevisiae) OC615 This paper BY4742, atg8::KanMX4, pho8::
pho8Δ60‐URA3KL
Legouis lab
Genetic reagent (S. cerevisiae) OC616‐OC617 This paper BY4742, atg8G116A, pho8::
pho8Δ60‐URA3KL
Legouis lab
Genetic reagent (S. cerevisiae) OC618‐OC619 This paper BY4742, atg8G116A‐R117*, pho8::
pho8Δ60‐URA3KL
Legouis lab
Strain strain background (E. coli) OP50 CGC see Material and Methods
Genetic reagent (E. coli) JA-C32D5.9 Open Biosystem lgg‐1 RNAi feeding bacterial clone
Genetic reagent (E. coli) JA-C56C10.12 Open Biosystem epg‐5 RNAi feeding bacterial clone
Genetic reagent (E. coli) JA-Y55F3AM.4 Open Biosystem atg-3 RNAi feeding bacterial clone;
Genetic reagent (E. coli) JA-M7.5 Open Biosystem atg-7 RNAi feeding bacterial clone
Genetic reagent (E. coli) JA-W03C9.3 Open Biosystem rab-7 RNAi feeding bacterial clone
Genetic reagent (E. coli) JA- Y39G10AR.10 Open Biosystem epg-2 RNAi feeding bacterial clone
Sequence-based reagent CrRNA(s) Paix et al., 2015 dpy-10 : 5’GCUACCAUAGGCACCACGAGGU
UUUAGAGCUAUGCUGUUUUG3’
Sequence-based reagent CrRNA(s) This paper lgg-1 Legouis lab 5’UACAGUGACGAAAGUGUG
UAGUUUUAGAGCUAUGCUGUUUUG3’
Sequence-based reagent Repair template Paix et al., 2015; dpy-10 : 5’CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT3’
Sequence-based reagent Repair template This paper lgg-1 (G116A): Legouis lab
5’CTTTACATCGCGTACAGTGACGAAAGTGTCTACGCCGGAGAGGTCGAAAAGAAGGAATAAAGTGTCATGTAT3’
Sequence-based reagent Repair template This paper lgg-1 (G116AG117 *): Legouis lab
5’TTCCTTTACATCGCCTACAGTGACGAAAGTGTGTACGCCTAAGAATTCGAAAAGAAGGAATAAAGTGTCATGTATTATCCG3’
Sequence-based reagent Repair template This paper lgg-1 (G116AG117A): Legouis lab
5’TTCCTTTACATCGCCTACAGTGACGAAAGTGTGTACGCCGCAGAGGTCGAAAAGAAGGAATAAGAATTCAGTGTCATGTATTATCCGCCGACGAATGTGTATAC3’
Sequence-based reagent Universal tracrRNA Dharmacon GE U-002000–05 5’AACAGCAUAGCAAGUUAAAAUAAGGCU
AGUCCGUUAUCAACUUGAAAAAGUGGC
ACCGAGUCGGUGCUUUUUUU3’
Peptide, recombinant protein S. pyogenes Cas9 Dharmacon CAS11201 Edit-R Cas9 Nuclease Protein, 1000 pmol
Antibody anti‐LGG‐1 (rabbit polyclonal) Springhorn and Hoppe, 2019 Ab#3 WB (1:3000)
Antibody anti‐LGG‐1 (rabbit polyclonal) Al Rawi et al., 2011 Ab#1 WB (1:200) IF(1:100)
Antibody anti‐LGG‐2 (rabbit polyclonal) Manil-Ségalen et al., 2014 WB (1:200) IF (1:200)
Antibody anti‐Tubulin (mouse monoclonal) Sigma 078K4763 WB (1:1000)
Antibody anti-SEL-1 (rabbit polyclonal) Hoppe’s lab WB (1:8000)
Antibody anti-CDC-48.1 (rabbit polyclonal) Hoppe’s lab WB (1:5000)
Antibody Anti-Rabbit HRP (goat polyclonal) Promega W401B WB (1:5000)
Antibody Anti-mouse HRP (goat polyclonal) Promega W4021 WB (1:10,000)
Antibody anti-GABARAP (rabbit polyclonal) Chemicon AB15278 IF (1:200)
Antibody anti-GFP (mouse monoclonal) Roche 1814460 IF (1:250)
Antibody anti-mouse IgG Alexa Fluor488 (goat polyclonal) Molecular Probes A11029 IF (1:500 to 1:1000)
Antibody anti-rabbit IgG Alexa Fluor488 (goat polyclonal) Molecular Probes A110034 IF (1:500 to 1:1000)
Antibody anti-rabbit IgG Alexa Fluor568 (goat polyclonal) Sigma-Aldrich A11036 IF (1:500 to 1:1000)
Antibody anti-GFP (rabbit polyclonal) Abcam ab6556 (Immunogold 1:10)
Antibody anti-rabbit IgG (goat polyclonal) Biovalley 810.011 Coupled to 10 nm colloidal gold particles (Immunogold 1:20)
Chemical compound, drug EPON Agar Scientific R1165 see Materials and methods
Chemical compound, drug lead citrate Sigma‐Aldrich 15326 see Materials and methods
Chemical compound, drug LRWHITE Electron Microscopy Sciences 14381 see Materials and methods
Peptide, recombinant protein LC3 traps Quinet et al., 2022 Molecular traps for LGG-1
Commercial assay or kit Super Signal Pico Chemiluminescent Substrate Thermo Scientific 34579 see Materials and methods
Commercial assay or kit NuPAGE 4%‐12% Bis‐ Tris gel Life Technologies NP0321BOX see Materials and methods
Software, algorithm ImageJ http://imagej.nih.gov/ij see Materials and methods
Software, algorithm Fidji https://fiji.sc/ see Materials and methods
Software, algorithm Prism GraphPad see Materials and methods
Software, algorithm R software https://www.r-project.org/ see Materials and methods
Software, algorithm Crispr http://Crispr.mit.edu see Materials and methods
Software, algorithm Crispor http://crispor.org see Materials and methods
Other MitoTracker Red CMXRos Molecular Probes M7512 see Materials and methods