Table 2. List of primers used for the gene detection and sequencing analysis in this study.
| Targeted gene | Enzyme | Sequence (5′– 3′) | Primer length/base | Amplicon size/bp | w(GC)/% | Melting temperature/°C | Reference |
|---|---|---|---|---|---|---|---|
| folK | Hydroxymethyl dihydropteridine pyrophosphokinase (EC 2.7.6.3) | F: CCATTTCCAGGTGGGGAATC | 20 | 214 | 55.0 | 55.8 | (24) |
| R: GGGGTGGTCCAAGCAAACTT | 20 | 55.0 | 58.2 | ||||
| folP | Dihydropteroate synthase (EC 2.5.1.15) | F: CCASGRCSGCTTGCATGAC | 19 | 261 | 65.8 | 60.8 | (24) |
| R: TKACGCCGGACTCCTTTTWY | 20 | 50.0 | 55.8 | ||||
| folQ | Dihydroneopterin triphosphate pyrophosphohydrolase (EC 3.6.1.-) | F: GGCTTGACTGCTCGTCAGTA | 20 | 214 | 55.0 | 56.9 | *designed in this study |
| R: TGACTGCAACCCCTAAGTCG | 20 | 55.0 | 57.0 | ||||
| folE | GTP cyclohydrolase I (EC 3.5.4.16) | F: CGGGTTGCACGAATGTATGC | 20 | 272 | 55.0 | 57.1 | *designed in this study |
| R: ACTGTCAACCGCTCCTGAAC | 20 | 55.0 | 57.4 | ||||
| folA | Dihydrofolate reductase (EC 1.5.1.3) | F: GACATGCAGCGGTTCAAAGC | 20 | 362 | 55.0 | 57.5 | *designed in this study |
| R: ACCGTCCCAATTTGTTGGCT | 20 | 50.0 | 57.7 | ||||
| folB | Dihydroneopterin aldolase (EC 4.1.2.25) | F: GGAAGAACGGCGTAATGGTC | 20 | 263 | 55.0 | 56.0 | *designed in this study |
| R: TTCCAGGCATTGGTACGCTA | 20 | 50.0 | 56.3 | ||||
| folC1 | Dihydrofolate synthase (EC 6.3.2.12) | F: AGTGAGCGATTTGGACAGCA | 20 | 331 | 50.0 | 57.0 | *designed in this study |
| R: AGTCGCTGCCATCCTTGAAA | 20 | 50.0 | 57.1 | ||||
| folC2 | Folylpolyglutamate synthase (EC 6.3.2.17) | F: GGCTGTTTTGCAGACCGAAG | 20 | 487 | 55.0 | 57.0 | *designed in this study |
| R: TGCGGGCGTATTCGTAATCA | 20 | 50.0 | 56.7 |
GC=guanine-cytosine