Antibodies |
|
Anti SiglecF-BV421 (clone E50-2440) |
BD Biosciences |
Cat# 562681; RRID: AB_2722581
|
Anti SiglecF-PE (clone E50-2440) |
BD Biosciences |
Cat# 552126; RRID: AB_394341
|
Anti CD11b-PerCP-Cy5.5 (clone M1/70 |
Biolegend |
Cat# 101228; RRID: AB_893232
|
Anti CD11c-BV510 (clone N418) |
Biolegend |
Cat# 117338; RRID: AB_2562016
|
Anti MHCII-FITC (clone M5/114.15.2) |
Biolegend |
Cat# 107606; RRID: AB_313321
|
Anti Ly6C-BV711 (clone HK1.4) |
Biolegend |
Cat# 128037; RRID: AB_2562630
|
Anti CD64-BV711 (clone X54-5/7.1) |
Biolegend |
Cat# 139311; RRID: AB_2563846
|
Anti CD64-PE (clone X54-5/7.1) |
Biolegend |
Cat# 139304; RRID: AB_10612740
|
Anti MerTK- APC (clone 2B10C42) |
Biolegend |
Cat# 151508; RRID: AB_2650739
|
Anti MerTK- FITC (clone 2B10C42) |
Biolegend |
Cat# 151504; RRID: AB_2617035
|
Anti Ki67-FITC (clone SolA15) |
eBioscience |
Cat# 11-5698-82; RRID: AB_11151330
|
Anti Ki67-APC (clone SolA15) |
eBioscience |
Cat# 17-5698-82; RRID: AB_2688057
|
Anti CD45-APC-Cy7 (clone 30-F11) |
Biolegend |
Cat# 103116; RRID: AB_312981
|
Anti CBFb (clone EPR6322) |
Abcam |
Cat# ab133600; RRID: |
IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibod |
LI-COR |
Cat# 926-32211 |
IRDye® 680RD Donkey anti-Mouse IgG Secondary Antibody |
LI-COR |
Cat# 926-68072 |
|
Chemicals, peptides, and recombinant proteins |
|
Zombie NIR™ Fixable Viability Kit |
Biolegend |
Cat# 423106 |
Zombie Aqua™ Fixable Viability Kit |
Biolegend |
Cat# 423102 |
Recombinant mouse GM-CSF |
Biolegend |
Cat# 576308 |
Recombinant mouse M-CSF |
Biolegend |
Cat# 574804 |
Ro 5-3335 |
TargetMol |
Cat# T4687 |
Protease Inhibitor Cocktail |
Sigma |
Cat# P8340-5ML |
|
Critical commercial assays |
|
Cellular Senescence Detection Kit - SPiDER-βGal |
Donjindo |
SG04-01 |
GenElute Mammalian Total RNAMiniprep Kit |
Sigma-Aldrich |
Cat# RTN350 |
BD PharMingen BrdU Flow Kits |
BD Biosciences |
Cat# 552598 |
eBioscience Foxp3 / TranscriptionFactor Staining Buffer Set |
Thermo Fisher Scientific |
Cat# 00-5523-00 |
Pierce BCA Protein Assay Kit |
Thermo Scientific |
Cat# 23225 |
NE-PER™ Nuclear and Cytoplasmic Extraction Reagents |
Thermofisher |
Cat# 78833 |
Revert™ 700 Total Protein Stain Kits for Western Blot Normalization |
LI-COR |
Cat# 926-11010 |
|
Deposited data |
|
Raw and analyzed scRNAseq of AMs from young and aged mice |
This paper |
GEO: GSE205982
|
Microarray of AMs from young and aged mice (Figure 3J) |
(Wong et al., 2017)21
|
GEO: GSE84901
|
Bulk-RNA-seq of AMs from young and aged mice (Figure 3K) |
(McQuattie-Pimentel et al., 2021)22
|
GEO: GSE134397
|
sc-RNA-seq of pneumoncytes of "Healthy" individuals (Figures 5 and S5) |
(Habermann et al., 2020)51
|
GEO: GSE135893
|
sc-RNA-seq of pneumoncytes of "Healthy" individuals (Figures 5 and S5) |
(Reyfman et al., 2019)52
|
GEO: GSE122960
|
sc-RNA-seq of pneumoncytes of rejected organ donors (Figures 5 and S5) |
(Morse et al., 2019)53
|
GEO: GSE128033
|
sc-RNA-seq of pneumoncytes of "Healthy" individuals (Figures 5 and S5) |
(Adams et al., 2020)54
|
GEO: GSE136831
|
Bulk-RNA-seq of different macrophages (Figure S1C) |
(Heng et al., 2008)35
|
ImmGen |
sc-RNA-seq of pneumoncytes of young (3-month) and aged (24-month) mice (Figure S2B and S2C) |
(Simon LM et al., 2019)37
|
GEO: GSE124872
|
|
Experimental models: organisms/strains |
|
C57BL/6J |
The Jackson Laboratory |
Cat# 000664 |
C57BL/6N |
National Institutes of Aging |
N/A |
Lyz2-cre |
The Jackson Laboratory |
Cat# 004781 |
Cbfbfl/fl
|
Laboratory of Dr. Thomas J. Braciale |
(Cardani et al., 2017) |
|
Oligonucleotides |
|
Cdkn1a-F qPCR |
GTCAGGCTGGTCTGCCTCCG |
N/A |
Cdkn1a-R qPCR |
CGGTCCCGTGGACAGTGAGCAG |
N/A |
Cdkn2a-F qPCR |
CCCAACGCCCCGAACT |
N/A |
Cdkn2a-R qPCR |
GCAGAAGAGCTGCTACGTGAA |
N/A |
Serpine1-F qPCR |
GACACCCTCAGCATGTTCATC |
N/A |
Serpine1-R qPCR |
AGGGTTGCACTAAACATGTCAG |
N/A |
mHprt qPCR-F |
CTCCGCCGGCTTCCTCCTCA |
N/A |
mHprt qPCR-R |
ACCTGGTTCATCATCGCTAATC |
N/A |
|
Software and algorithms |
|
GraphPad Prism 9 |
GraphPad Software |
http://www.graphpad.com |
FlowJo (version 10.3) |
LLC |
https://www.flowjo.com/ |
Image Studio™ Lite Quantification Software |
LI-COR |
N/A |
Cell Ranger v2.0.0 |
10X Genomics |
|
R project |
|
https://www.r-project.org/ |
R studio |
Posit |
https://posit.co/ |
Seurat |
Satija lab |
https://satijalab.org/seurat/ |
Monocle3 |
Trapnell lab |
https://cole-trapnell-lab.github.io/monocle3/ |
Gene Set Enrichment Anlaysis (GSEA) |
UC San Diego and Broad Institute |
http://www.gsea-msigdb.org/gsea/index.jsp |