Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| DYKDDDDK Epitope Tag Alexa Fluor 647-conjugated Antibody | R&D Systems | IC8529R |
| Bacterial and virus strains | ||
| Endura Electrocompetent Cells | Lucigen | 60242–2 |
| Chemicals, peptides, and recombinant proteins | ||
| Doxycycline hyclate | Tocris | 4090 |
| Celastrol | Tocris | 3203 |
| SGC-CBP30 | Selleck Chemicals | S7256 |
| Tazemetostat | Selleck Chemicals | S7128 |
| TMP269 | Selleck Chemicals | S7324 |
| Human Interferon beta | PeproTech | 300–02BC |
| Critical commercial assays | ||
| Dynabeads M-280 Protein G | Thermo Fisher | 10003D |
| NEBNext Ultra II RNA Library Prep Kit | New England Biolabs | E7770S |
| NEBNext Poly(A) mRNA Magnetic Isolation Module | New England Biolabs | E7490 |
| Deposited data | ||
| Raw HT-Recruit sequencing files | This manuscript | BioProject PRJNA930640 |
| Raw and analyzed RNA-seq data | This manuscript | BioProject PRJNA930640; GEO GSE224325 |
| Human reference genome NCBI build 38, GRCh38 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| EBV type 1 B95-8 strain reference sequence | NCBI | NC_007605.1 |
| EBV type 2 AG876 strain reference sequence | GenBank | DQ279927.1 |
| Experimental models: Cell lines | ||
| Human: HEK293T Lenti-X | Takara | 632180 |
| Human: K562 | ATCC | CCL-243 |
| Human: K562 with pJT039 pEF reporter | Tycko et al.8 | N/A |
| Human: K562 with pDY32 minCMV reporter | Tycko et al.8 | N/A |
| Human: Cas9+ iSLK-BAC16-K8.1pr-mIFP2 | Morgens et al.58 | N/A |
| Oligonucleotides | ||
| vTR and CoV tiling libraries | Twist; see Table S1 | N/A |
| Spike DMS library | Twist; see Table S1 | N/A |
| HHV tiling library | Twist; see Table S2 | N/A |
| HHV perturbation library | Twist; see Table S3 | N/A |
| HHV hits library | Twist; see Table S3 | N/A |
| HT-Recruit NGS library prep primers | Tycko et al.8 | N/A |
| Recombinant DNA | ||
| pJT039 AAVS1-PuroR-9xTetO-pEF-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA | Tycko et al.8 | Addgene #161927 |
| pDY32 AAVS1-PuroR-9xTetO-minCMV-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA | Tycko et al.8 | Addgene #161928 |
| pJT126 lenti pEF-rTetR(SE-G72P)-3XFLAG-LibCloneSite-T2A-mCherry-BSD-WPRE | Tycko et al.8 | Addgene #161926 |
| pCL040 lenti TRE-3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherry-BSD-WPRE | This manuscript | Addgene #198054 |
| pMD2.G | Didier Trono | Addgene #12259 |
| pRSV-Rev | Didier Trono | Addgene #12253 |
| pMDLg/pRRE | Didier Trono | Addgene #12251 |
| Software and algorithms | ||
| HT-Recruit analysis pipeline | Tycko et al.8 | https://github.com/bintulab/HT-recruit-Analyze |
| Cytoflow | Teague67 | https://cytoflow.github.io/ |
| DESeq2 | Love et al.52 | DOI: 10.18129/B9.bioc.DESeq2 |
| Custom analyses | This manuscript | https://github.com/bintulab/Viral_Ludwig_2022 (version of record deposited at DOI: 10.5281/zenodo.7874429) |
| Other | ||
| Miscellaneous data and resources | This manuscript | https://github.com/bintulab/Viral_Ludwig_2022 (version of record deposited at DOI: 10.5281/zenodo.7874429) |
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This manuscript | N/A |
| Bacterial and virus strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al.1 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al.2) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC | ATCC 700294 |
| Biological samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children’s Oncology Group Cell Culture and Xenograft Repository | http://cogcell.org/ |
| Chemicals, peptides, and recombinant proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350–13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433–59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 124–87-8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14-486 |
| GST-BMAL1 | Novus | Cat#H00000406-P01 |
| Critical commercial assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | PerkinElmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202-1012 |
| Deposited data | ||
| Raw and analyzed data | This manuscript | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This manuscript | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference | This manuscript; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This manuscript; Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental models: Cell lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental models: Organisms/strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and Nuesslein-Volhard3 | ZFIN: ZDB-GENO-060207-1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al.4 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This manuscript | N/A |
| Primers for XX, see Table SX | This manuscript | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This manuscript | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT | Gene Tools | ZFIN: ZDB-MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA | This manuscript | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This manuscript | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl013041 5 |
| AAV2/1-hsyn-GCaMP6-WPRE | Chen et al.5 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al.6 | Addgene Plasmid #21339 |
| Software and algorithms | ||
| ImageJ | Schneider et al.7 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg8 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al.9 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al.10 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This manuscript; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal | This manuscript | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This manuscript | https://github.com/chrisamiller/aml31SuppSite |
| Chemicals, peptides, and recombinant proteins | ||
| QD605 streptavidin conjugated quantum dot | Thermo Fisher Scientific | Cat#Q10101MP |
| Platinum black | Sigma-Aldrich | Cat#205915 |
| Sodium formate BioUltra, ≥99.0% (NT) | Sigma-Aldrich | Cat#71359 |
| Chloramphenicol | Sigma-Aldrich | Cat#C0378 |
| Carbon dioxide (13C, 99%) (<2% 18O) | Cambridge Isotope Laboratories | CLM-185-5 |
| Poly(vinylidene fluoride-co-hexafluoropropylene) | Sigma-Aldrich | 427179 |
| PTFE Hydrophilic Membrane Filters, 0.22 μm, 90 mm | Scientificfilters.com/Tisch Scientific | SF13842 |
| Critical commercial assays | ||
| Folic Acid (FA) ELISA kit | Alpha Diagnostic International | Cat# 0365–0B9 |
| TMT10plex Isobaric Label Reagent Set | Thermo Fisher | A37725 |
| Surface Plasmon Resonance CM5 kit | GE Healthcare | Cat#29104988 |
| NanoBRET Target Engagement K-5 kit | Promega | Cat#N2500 |
| Deposited data | ||
| B-RAF RBD (apo) structure | This manuscript | PDB: 5J17 |
| Structure of compound 5 | This manuscript; Cambridge Crystallographic Data Center | CCDC: 2016466 |
| Code for constraints-based modeling and analysis of autotrophic E. coli | This manuscript | https://gitlab.com/elad.noor/sloppy/tree/master/rubisco |
| Software and algorithms | ||
| Gaussian09 | Frish et al.1 | https://gaussian.com |
| Python version 2.7 | Python Software Foundation | https://www.python.org |
| ChemDraw Professional 18.0 | PerkinElmer | https://www.perkinelmer.com/category/chemdraw |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al.2 | https://github.com/ChristophRau/wMICA |
| Other | ||
| DASGIP MX4/4 Gas Mixing Module for 4 Vessels with a Mass Flow Controller | Eppendorf | Cat#76DGMX44 |
| Agilent 1200 series HPLC | Agilent Technologies | https://www.agilent.com/en/products/liquid-chromatography |
| PHI Quantera II XPS | ULVAC-PHI, Inc. | https://www.ulvac-phi.com/en/products/xps/phi-quantera-ii/ |