Table 1.

List of candidate genes used in this study for quantitative real-time PCR, their primer details, and function in the virulence and pathogenicity of C. albicans.

Gene	Function	Primer sequence (5ʹ–3ʹ)	References
als3	Agglutinin-like protein that is vital for adhesion to oral mucosa and epithelial cells. Mediates yeast aggregation that acts as a primary step in biofilm formation	F: CAACTTGGGTTATTGAAACAAAAACA R: AGAAACAGAAACCCAAGAACAACC	Green et al., 200669
hwp1	Hyphal wall protein gene essential for hyphal elongation	F: GCTCCTGCTCCTGAAATGAC R: CTGGAGCAATTGGTGAGGTT	Carlisle and Kadosh, 201370
ume6	Transcriptional activator of filamentous growth. Regulates hyphal elongation and germ tube formation	F: ACCACCACTACCACCACCAC R: TATCCCCATTTCCAAGTCCA
eap1	Associated with cell adhesion and filamentation. Initiates adhesion to polystyrene and epithelial cells	F: TGTGATGGCGGTTCTTGTTC R: GGTAGTGACGGTGATGATAGTGACA	Fox et al., 201371
efg1	A transcription factor that regulates switch between white and opaque cells and cell wall dynamics. Essential for biofilm formation and filamentous growth	F: GCCTCGAGCACTTCCACTGT R: TTTTTTCATCTTCCCACATGGTAGT	Kumamoto and Vinces, 200572
cph1	Transcription factor involved in pseudohyphal and hyphal formation and phenotypic switching	F: TATGACGCTTCTGGGTTTCC R: ATCCCATGGCAATTTGTTGT
ras1	Mediates cell adhesion, induces filamentous growth, regulates phenotypic switching	F: CCCAACTATTGAGGATTCTTATCGTAAA R: TCTCATGGCCAGATATTCTTCTTG	Inglis and Sherlock, 201373
hst7	Filamentation required for opaque mating or white biofilm formation	F: TCATCAGCTTCTTCTATAC R: TATTGAGGAAATGACAGTT	Köhler and Fink, 199674