Table 1.
The GP5 primer sequence used in the RT-PCR in this study.
| Primer | Amplified fragment | Primer sequences |
|---|---|---|
| Detection primers | GP5-F | ACCTGAGACCATGAGGTGGGC |
| GP5-R | GCCAGAATGTACTTGCGGCCTA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.