Skip to main content
. 2023 Jul 7;14:1192028. doi: 10.3389/fimmu.2023.1192028

Table 2.

AUF-1-bound mRNAs, with relative EF (AUF-1 IP vs Input), selected for biotin pull-down validation.

Gene symbol Full name EF 3’UTR pulled-down fragment (Table S2)
GLIS2 GLIS Family Zinc Finger 2 4.95 B
MUC1 Mucin 1, Cell Surface Associated 3.37 Isoform 1
FoxP4 Forkhead Box P4 3.27 A
TGF-β1 Transforming growth factor beta 1 2.16 Full length
EGR1 Early growth response 1 2.15 Full length
DDX17 DEAD-Box helicase 17 2.13 A, B, C
HDAC2 Histone deacetylase 2 1.7 A, D
IL-6 Interleukin-6 As control Full length
GC-rich motif CCTGTAATCTCAGCCTCCTGGGAGGCTGAGA