Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma

. 2023 May 11;3(7):100321. doi: 10.1016/j.xgen.2023.100321

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

Actin	Bio-Rad	Cat#12004163, RRID:AB_2861334
H3K27ac	Active Motif	Cat#39133, RRID:AB_2561016
JUN	Cell Signaling	Cat#9165S, RRID:AB_2130165
MDM2	Abcam	Cat#ab226939, RRID:AB_2754988
P53	Cell Signaling	Cat#48818, RRID:AB_2713958
PML	Santa Cruz	Cat#sc-966, RRID:AB_628162
RUNX2	Cell Signaling	Cat#12556S, RRID:AB_2732805
YY1	Santa Cruz	Cat#sc-7341, RRID:AB_2257497
Drosophila spike-in chromatin antibody	Active Motif	Cat#61686, RRID:AB_2737370

Biological samples

See Table S1 for a list of patient samples included in the study		N/A

Chemicals, peptides, and recombinant proteins

HDM201	SelleckChem	Cat#S8606
Nutlin-3a	SelleckChem	Cat#S8059
Navitoclax	SelleckChem	Cat#S1001
Klenow Fragment (3-5exo-)	NEB	Cat#M0212L
Drosophila spike-in chromatin	Active Motif	Cat#53083
MboI	NEB	Cat# R0147M
Biotin-dATP	ThermoFisher	Cat#195224016
Streptavidin M280 beads	Invitrogen	Cat#11205D
RIPA buffer	Life Technologies	Cat#89900
HALT protease phosphatase inhibitor cocktail	ThermoFisher	Cat#78440
Cell Titer-Glo	Promega	Cat#G7570
16% Formaldehyde	Life Technologies	Cat#28908
Vectashield	Vector labs	Cat#H-1000-10
Fluoromount G	Invitrogen	Cat#00495802
KaryoMAX colcemid solution	Life Technologies	Cat#15212012
DAPI (4′,6-Diamidino-2-Phenylindole, Dihydrochloride)	Thermo Fisher	Cat#D1306

Critical commercial assays

QIAGEN RNeasy lipid kit	Qiagen	Cat#74804
End-It DNA repair kit	Biosearch Technologies	Cat#ER0720
KAPA HiFi HotStart ReadyMix PCR Kit	Roche	Cat#07958935001
Zymo Clean and Concentrate Kit	Zymo	Cat#DCC-100
Nextera DNA library prep kit	Illumina	Cat#20018704
BCA protein assay kit	ThermoFisher	Cat#23227
Dead cell apoptosis kit	Invitrogen	Cat#V13241

Deposited data

Sequencing data	This paper	GEO: GSE213300
Human transcriptomic data derived from the TCGA	Xena curated data repository	https://pancanatlas.xenahubs.net
H3K27ac HiChIP of normal tissues	Mumbach et al.²⁰	GEO: GSE101498

Experimental models: Cell lines

HCT116	ATCC	Cat#CCL-247, RRID:CVCL_0291
U-2 OS	ATCC	Cat#HTB-96, RRID:CVCL_0042
LPS141	gift from Dr. Adrian Marino-Enriquez	Brigham and Women’s Hospital
LPS853	gift from Dr. Adrian Marino-Enriquez	Brigham and Women’s Hospital
93T449	gift from Dr. Adrian Marino-Enriquez	Brigham and Women’s Hospital
94T778	gift from Dr. Adrian Marino-Enriquez	Brigham and Women’s Hospital

Oligonucleotides

Safe harbor sgRNA	IDT	GGCTAAATTCCTCTTATTCA
TP53 sgRNA	IDT	TCGACGCTAGGATCTGACTG
PCR of P53 CRISPR targeting region -Forward primer	IDT	CCCAACCCTTGTCCTTACCA
PCR of P53 CRISPR targeting region -Reverse primer	IDT	CAACATGCAAAGCCCTGTCT
Chr12 FISH probes	Empire Genomics	Cat#CHR12-10-GR
MDM2 FISH probes	Empire Genomics	Cat#MDM2-20-OR

Recombinant DNA

pXPR_044, all in one CRISPR-Cas9 vector	gift from John Doench and Dave Root	Broad Institute, Genomics Perturbation Plat-form

Software and algorithms

Code supporting this study	This paper	https://github.com/BernsteinLab/methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766
STAR	Dobin et al.⁷⁸	version 2.7.10
Juicebox	Durand et al.⁷⁹	http://aidenlab.org/juicebox/
Hichipper	Lareau et al.⁸⁰	version 0.7.9
HiC-Pro	Servant et al.⁸¹	version 2.10.0
Bioconductor	Huber et al.5⁸²	Release 3.13
Homer	Heinz et al.⁸³	version 4.11
Samtools	Danecek et al.⁸⁴	version 1.15.1
Bedtools	Quinlan et al.⁸⁵	version 2.29.0
HTSlib	Bonfield et al.⁸⁶	version 1.15.1
FIJI	Schindelin et al.⁸⁷	version 2.0.0-rc-43/1.5h
CellProfiler	Stirling et al.⁸⁸	version 4.2.1
SynergyFinder	Ianevski et al.⁸⁹	version 1.6.1
FlowJo	BD biosciences	version 10.8.0