Table 4. Potential crRNAs with respective target loci, sequence and specificity, and efficacy scores according to CRISPOR.

The most promising crRNAs (*) have been tested by in vitro digestion (Figure 2). Two asterisks (**) mark the crRNA chosen for zygote microinjection.

crRNA	Target	Sequence	MIT	CFD	Doench ‘16	Mor.-Mateos
guide_29/fw_ex2	Exon 2	CAAAACATGAGGATATTTGC	68	79	44	12
guide_63/fw_ex2	Exon 2	CAGCCTGCTGTCACTTGCTA	68	82	46	56
guide_64/fw_ex2*	Exon 2	AGCCTGCTGTCACTTGCTAC	79	91	48	36
guide_22/fw_ex3*	Exon 3	GTTTACTATCACGGCTCCAA	91	96	63	41
guide_61/fw_ex3**	Exon 3	GTATGGCAGCAACGTCACGA	96	96	66	44
guide_109/fw_ex3	Exon 3	GCTGGACCTGCTTGCGTTAG	94	97	42	66
guide_95/rev_ex3	Exon 3	AGTACACCACTAACGCAAGC	93	97	60	9