Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences to determine the egg sex ratio
| primers | F-sequence | B-sequence | Annealing temperature | Product size | Target region | Sensitivity | Specificity | Reference |
|---|---|---|---|---|---|---|---|---|
| SHB-Y | TGACAACTCATAACCTGTTGGAT | ACAGGATGGTTTCCCTGCTC | 60°C | 569 bp | Y chromosome | 100% | 100% | This study |
| Universal | GCTAAGTTAACTGAAGATCCACCAT | TAGTTCCACTAATACTAAGAGCCCC | 56°C | 190 bp | mitochondria | 100% | 52.63% | [76] |
