Table 2.
PCR conditions Amplification and sequencing analysis primers and PCR conditions
| Exon | Primer sequence (5 '-3 ') | Annealing temperature (℃) | Polymerase | Product (bp) |
|---|---|---|---|---|
| 22 | TGACAGAGCCCTAGGGCTTA | 60 | AmpliTag | 279 bp |
| CATTGTTTGGAGCAGCAGAG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.