TABLE 1.
Oligonucleotide primers, plasmids, and bacterial strains used in this study
| Oligonucleotide primer, plasmid, or strain | Coordinates in rocFa | Relevant genotype or description | DNA sequence (5′ to 3′) | Source or reference |
|---|---|---|---|---|
| Primersb | ||||
| RocF-F3 (for) | −149–−130 | GCCTGCAGTATTGGGGTGTTTTTCTATC (PstI site underlined) | ||
| RocF-R13 (for) | 18–37 | AACTGCAGAAGCAGAGTTAGGAGCG (PstI site underlined) | ||
| RocF-F4 (for) | 204–223 | AAATCTGATCCCTTGCATGA | ||
| RocF-R14 (rev) | 339–360 | CGGGATCCGCATGCGCGTCTAAATAC (BamHI site underlined) | ||
| RocF-R6 (rev) | 554–573 | TTCGCTCTGTTCGGTGCTTC | ||
| RocF-R15 (for) | 562–580 | CGGGATCCGAACAGAGCGAAAGAGATG (BamHI site underlined) | ||
| RocF-R17 (rev) | 691–708 | GTCCAAATCCAAACTGAG | ||
| RocF-R16 (rev) | 898–915 | CGGAATTCGATGAGATCTAAGATCTC (EcoRI site underlined) | ||
| RocF-R5 (rev) | 987–1006 | GGATCGATCTTTTTCAACCTTTTATCGT (ClaI site underlined) | ||
| Kan-H16 (rev) | NA | CGGTATAATCTTACCTATCACCTCA | ||
| Kan-K4 (rev) | NA | TCCAATTCACTGTTCCTT | ||
| Kan-K5 (for) | NA | TATATTTAAAAATGACGG | ||
| Kan-K8 (for) | NA | TTTGACTTACTGGGGATCAAGCCTG | ||
| Plasmids (parent) | ||||
| pBluescript II SK (−) | Apr, cloning vector | Stratagene | ||
| pBS-rocF (pBluescript II SK) | Apr, 1,154-bp rocF PCR product (nucleotides −149 to 1006) cloned into the PstI and ClaI sites | This study | ||
| pBS-rocF::aphA3 (pBluescript II SK) | Apr Knr, 1.2-kb EcoRI aphA3 cassette from pHP1 ligated to the EcoRI site of rocF in pBS-rocF | This study | ||
| pHP1 (pUC19) | Apr Knr, source of aphA3 cassette | H. Kleanthous | ||
| pILL570 | Spr, cloning vector | 11 | ||
| pILL570 Not (pILL570) | Spr, NotI and EcoRI sites have been introduced between the ClaI and HindIII sites in the pILL570 polylinker | This study | ||
| pILL600 | Knr, source of aphA3 cassette | 12 | ||
| pILL235 (pILL570 Not) | Spr, 676-bp rocF spliced PCR products (nucleotides 18 to 339 and 562 to 915) | This study | ||
| pILL236-2 (pILL570) | Spr Knr, aphA3 cassette from pILL600 ligated to the BamHI site in rocF in pILL235 | This study | ||
| Strains | ||||
| E. coli DH5α | F−supE44 ΔlacU169 (φ80 lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 | Bethesda Research Laboratories | ||
| H. pylori | ||||
| 26695 | WT, genome sequenced | 4, 34 | ||
| 26695 rocF::aphA3 | 26695 allelic exchange arginase (rocF) mutant by using pBS-rocF::aphA3 | This study | ||
| N6 | WT, naturally transformable laboratory strain | 6 | ||
| N6 236-2 | N6 allelic exchange arginase (rocF) mutant by using pILL236-2 | This study | ||
| N6 rocF::aphA3 | N6 allelic exchange arginase (rocF) mutant by using pBS-rocF::aphA3 | This study | ||
| SS1 | WT (mouse-adapted) | 13 | ||
| SS1 236-2 | SS1 allelic exchange arginase (rocF) mutant by using pILL236-2 | This study | ||
| SS1 rocF::aphA3 | SS1 allelic exchange arginase (rocF) mutant by using pBS-rocF::aphA3 | This study |
a
+1 refers to the A residue in the start codon of rocF. The coding region of rocF is +1 to +969. Negative numbers refer to upstream residues. NA, not applicable.
b
for, forward; rev, reverse.