Skip to main content
. Author manuscript; available in PMC: 2023 Jul 27.
Published in final edited form as: Cell. 2023 Jul 5;186(15):3148–3165.e20. doi: 10.1016/j.cell.2023.06.002

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-mouse CD3 (17A2) Alex488 BioLegend 100220; RRID:AB_1732057
Anti-mouse CD8a (53–6.7) BUV395 BD Biosciences 563786; RRID:AB_2732919
Anti-mouse CD8a (53–6.7) BV421 BioLegend 100738; RRID:AB_11204079
Anti-mouse CD4 (RM4–5) FITC BioLegend 100510; RRID:AB_312713
Anti-mouse CD25 (PC61) APC-Cy7 BioLegend 102026; RRID:AB_830745
Anti-mouse B220 (RA3–6B2) PE-cy7 BioLegend 103222; RRID: AB_313005
Anti-mouse PD-1 (29F.1A12) BV421 BioLegend 135218; RRID:AB_2561447
Anti-mouse TIM3 (RMT3–23) APC BioLegend 119706; RRID:AB_2561656
Anti-mouse CD45 (30-F11) Percp-cy5.5 BioLegend 103132 RRID: AB_893340
Anti-mouse CD45.1 (A20) BV421 BioLegend 110732 BRID: AB_2562563
Anti-mouse CD45.2 (104) BUV737 BD Biosciences 612778; RRID:AB_2870107
Anti-mouse CD317 (927) Alex488 BioLegend 127012 RRID: AB_1953287
Anti-mouse CD11c (N418) FITC BioLegend 117306; RRID:AB_313775
Anti-mouse CD11b (M1/70) APC-Cy7 BioLegend 101226; RRID:AB_830642
Anti-mouse CD24 (M1/69) BV711 BioLegend 563450; RRID:AB_2738213
Anti-mouse MHC II (M5/114.15.2) BV605 BioLegend 107639; RRID:AB_2565894
Anti-mouse F4/80 (T45–2342) BUV395 BD Biosciences 565614; RRID:AB_2739304
Anti-mouse CD86 (GL-1) PE-Dazzle 594 BioLegend 105042; RRID:AB_2566409
Anti-mouse CD103 (2E7) PE BioLegend 121406; RRID:AB_1133989
Anti-mouse CD45.1 (A20) APC BioLegend 110714; RRID:AB_313503
Anti-mouse IFN-γ (XMG1.2) PE BioLegend 505808; RRID:AB_315402
Anti-mouse TNF-α (MP6-XT22) APC BioLegend 506308; AB_315429
Anti-mouse Granzyme B (QA16A02) APC BioLegend 372204; RRID:AB_2687028
Anti-mouse FoxP3 (150D) PE BioLegend 320007 AB_492981
Anti-mouse PGC-1a (D-5) PE Santa Cruz sc-518025 PE
Anti-mouse Ki67 (11F6) BV421 BioLegend 151208 RRID: AB_2629748
Anti-mouse CD206 PE BioLegend 141706 RRID: AB_10895754
1E4.2.1 anti-Env antibody Wittrup lab at MIT N/A
Anti-mouse IFN-γ (XMG1.2) BioXCell BE0055; RRID:AB_1107694
Anti-mouse TNF-α (XT3.11) BioXCell BE0058; RRID:AB_1107764
Anti-mouse CD3ε (2C11) BioXCell BE0001–1 BRID:AB_1107634
Anti-mouse CD28 (37.51) BioXCell BE0015–1 BRID:AB_1107624
Anti-CD45.1 (A20) Stem cell Tech 60117BT
Anti-CD45.2 (104) Stem cell Tech 60118BT
Bacterial and virus strains
5-alpha Competent E. coli New England Biolabs C2987U
Chemicals, peptides and recombinant proteins
1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide (polyethylene glycol)-2000] Layson Bio 100220
DSPE-PEG-FITC Avanti 810120
Cyclic-di-GMP invivogen tlrl-nacdg
Resiquimod invivogen tlrl-r848
GolgiPlug Protein Transport Inhibitor (containing Brefeldin A) BD Biosciences BDB555029
Cell Stimulation Cocktail eBioscience 00–4970-93
Protease Inhibitor Cocktail Roche 5892970001
Recombinant murine IL-2 Biolegend 575408
Recombinant murine IFN-γ Peprotech 315–05
DNase I Sigma Aldrich 10104159001
Collagenase IV Worthington LS004188
CalPhos Mammalian Transfection Kit Takara 631312
Sytox Red Thermo Fisher S34859
Retronectin Takara T100B
TRIzol Reagent Thermo Fisher 15596018
iTAg Tetramer/PE – H-2 Kb OVA (SIINFEKL) MBL international TB-5001–1
Critical commercial assays
NucleoSpin® Plasmid Takara 740588.250
TrypLE Express Enzyme Thermo Fisher 12605036
Gibco ACK Lysing Buffer Thermo Fisher A10492–01
CellTrace Violet Thermo Fisher C34557
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Thermo Fisher L34966
FITC Annexin V Apoptosis Detection Kit BD Biosciences 556547
Fixation/Permeabilization Solution Kit BD Biosciences 554714
Foxp3 / Transcription Factor Staining Buffer Set eBioscience 00–5523-00
Mouse CD45 microbeads Miltenyi Biotec 130–052-301
EasySep Mouse CD8+ T Cell Isolation Kit Stemcell Technologies 19853
Mouse IFN-γ ELISA kit R&D systems DY485
Mouse IL-2 ELISA kit Invitrogen 88–7024
Mouse IFN-γ ELISPOT Kit BD Biosciences 551083
RNeasy Micro Kit Qiagen 74004
T-PERTM Thermo Fisher 78510
Proteinase and phosphatase inhibitors Thermo Fisher 78442
iScript Reverse Transcription Supermix Biorad 1708841
LEGENDplex assays BioLegend 740621
Deposited data
Bulk RNA-seq data GEO GSE211938
sc RNA-seq data GEO GSE212453
Experimental Models: Cell Lines
B16F10 cells ATCC CRL-6475; RRID:CVCL_0159
CT-2A cells T. Seyfried Lab at Boston college N/A
MHCII+ CT-2A cells Generated in the Irvine lab N/A
mEGFRvIII-CT-2A cells Generated in the Irvine lab N/A
ZsGreen+ mEGFRvIII-CT-2A cells Generated in the Irvine lab N/A
mEGFRvIII-CT-2A-OVA cells Generated in the Irvine lab N/A
293 phoenix cells ATCC CRL-3214
B16F10-OVA cells G. Dranoff Lab at DFCI N/A
2C TCR-58−/− T cell hybridoma cells Birnbaum lab at MIT N/A
7PPG2 TCR-58−/− T cell hybridoma cells Birnbaum lab at MIT N/A
MC38 cells Wittrup lab at MIT N/A
TC-1 cells ATCC CRL-2493
TRP1−/− B16F10 cells Generated in the Irvine lab N/A
Experimental Models: Organism/Strains
C57BL/6J mice, CD45.2+ Jackson Laboratory 000624; RRID:IMSR_JAX:000624
C57BL/6J mice, CD45.1+ Jackson Laboratory 002014; RRID:IMSR_JAX:002014
Rag1−/− (B6.129S7-Rag1tm1Mom/J) Jackson Laboratory 013755; RRID:IMSR_JAX:013755
IFNGR1−/− (B6.129S7-Ifngr1tm1Agt/J) Jackson Laboratory 003288; RRID:IMSR_JAX:00328
Batf3−/− (B6.129S(C)-Batf3tm1Kmm/J) Jackson Laboratory 013755; RRID:IMSR_JAX:013755
CD11c-cre (C57BL/6J-Tg(Itgax-cre,-EGFP)4097Ach/J ) Jackson Laboratory 007567; RRID:IMSR_JAX:007567
IFNGR1-flox (C57BL/6N-Ifngr1tm1.1Rds/J) Jackson Laboratory 025394; RRID:IMSR_JAX:025394
PGC-1α-flox (B6N.129(FVB)-Ppargc1atm2.1Brsp/J) Jackson Laboratory 009666 RRID:IMSR_JAX:009666
LCK-cre (B6.Cg-Tg(Lck-cre)548Jxm/J) Jackson Laboratory 003802 RRID:IMSR_JAX:003802
IL12rb2−/− (B6;129S1-Il12rb2tm1Jm/J) Jackson Laboratory 003248 RRID:IMSR_JAX:003248
IL12p40−/− (B6.129S1-Il12btm1Jm/J Jackson Laboratory 002693 RRID:IMSR_JAX:002693
IFNγ −/− (B6.129S7-Ifngtm1Ts/J) Jackson Laboratory 002287; RRID:IMSR_JAX:002287
CD8α −/− (B6.129S2-Cd8atm1Mak/J) Jackson Laboratory 002665 RRID:IMSR_JAX:002665
Oligonucleotides
Ccl4 qPCR primers
For: CCAAGCCAGCTGTGGTATTCC
Rev: GAGCTGCTCAGTTCAACTCC
Sigma-Aldrich N/A
Ccl5 qPCR primers
For: GCTGCTTTGCCTACCTCTCC
Rev: TCGAGTGACAAACACGACTGC
Sigma-Aldrich N/A
Itgb1 qPCR primers
For: ATGCCAAATCTTGCGGAGAAT
Rev: TTTGCTGCGATTGGTGACATT
Sigma-Aldrich N/A
Itga4 qPCR primers
For: GATGCTGTTGTTGTACTTCGGG
Rev: ACCACTGAGGCATTAGAGAGC
Sigma-Aldrich N/A
Cx3cr1 qPCR primers
For: CCCATCTGCTCAGGACCTC
Rev: ATGGTTCCAAAGGCCACAATG
Sigma-Aldrich N/A