Skip to main content
PLOS One logoLink to PLOS One
. 2023 Jul 27;18(7):e0289178. doi: 10.1371/journal.pone.0289178

Evaluation of an inducible knockout system in insect cells based on co-infection and CRISPR/Cas9

Christina Sophie Hausjell 1, Miriam Klausberger 1, Wolfgang Ernst 1, Reingard Grabherr 1,*
Editor: Jian Xu2
PMCID: PMC10374150  PMID: 37498808

Abstract

Due to comparably high product titers and low production costs, the baculovirus/insect cell expression system is considered a versatile production platform in the biopharmaceutical industry. Its excellence in producing complex multimeric protein assemblies, including virus-like particles (VLPs), which are considered promising vaccine candidates to counter emerging viral threats, made the system even more attractive. However, the co-formation of budded baculovirus during VLP production poses a severe challenge to downstream processing. In order to reduce the amount of budded baculovirus in the expression supernatant we developed an inducible knockout system based on CRISPR/Cas9 and co-infection with two baculoviral vectors: one bringing along the Cas9 nuclease and the other one having incorporated the sequence for sgRNA expression. With our set-up high titer viruses can be generated separately, as only when both viruses infect cells simultaneously a knockout can occur. When budding essential genes gp64 and vp80 were targeted for knockout, we measured a reduction in baculovirus titer by over 90%. However, as a consequence, we also determined lower overall eYFP fluorescence intensity showing reduced recombinant protein production, indicating that further improvements in engineering as well as purification are required in order to ultimately minimize costs and timeframes for vaccine production utilizing the baculovirus/insect cell expression system.

Introduction

In recent years, the baculovirus/insect cell expression system has been extensively applied for the production of numerous biotechnologically relevant compounds. Due to the possibility of inserting large gene fragments and expressing multiple foreign genes simultaneously, it is especially suitable for the production of multimeric protein vaccines, such as virus-like particles (VLPs) as well as gene therapy vectors in particular AAVs [1]. The expression platform brings along various advantageous attributes, including the capability of carrying-out mammalian-like posttranslational modifications, cultivation in serum-free suspension cultures in absence of CO2 and comparably high product titers and is thus, progressively used in industrial applications [2].

However, the main bottleneck within the system is the co-formation of baculovirus particle impurities during recombinant protein expression, greatly impeding the downstream process of VLP products [3,4]. Pharmaceutical products must undergo rigorous purification in order to assure their safety for human use. Although, baculoviruses are insect-specific and do not replicate in mammalian cells, they have been shown to be able to enter human cells and provoke antiviral responses in the mouse model [57]. Therefore, thorough purification processes need to be established in order to efficiently remove residual baculoviral impurities from the preparations. However, similar characteristics, regarding size, density and surface proteome between budded virus and enveloped VLPs, complicates their separation, frequently resulting in low process efficiency and inadequate product purity [8].

So far, several attempts have been made trying to decrease the amount of baculovirus impurities that is generated during the production process. In this respect, genes, essential for virus budding such as gp64, the baculovirus major envelope glycoprotein gene, or the vp80 capsid gene have been deleted from the viral genome and thereby almost completely abolished virus budding [9,10]. Yet, in order to generate high titer virus stocks for recombinant protein production, helper cell lines that complement for the missing gene, are indispensable. Viral amplification and working stock production with complementing cell lines, however, is frequently accompanied by low efficiency and associated with overall low process productivity.

Alternative strategies for reducing virus progeny are based on RNA interference, utilizing siRNAs or dsRNAs to downregulate the expression of genes essential for budding, instead of knocking them out. Although, several of these attempts showed promising results in proof-of-concept studies, none of them are feasible for large scale production [11,12]. Others have utilized engineered insect cell lines to stably express foreign genes, omitting the need for baculovirus infection. However, product titers so far have not reached the ones obtained with the baculovirus expression vector system [13,14].

More recent strategies employ the CRISPR/Cas9 system for the knock-out/-down of viral essential genes. Bruder et al. reported a system relying on insect cell lines stably expressing Cas9 and baculoviruses engineered to support transcription of guide RNAs targeting viral essential genes, including vp80, iE1 or gp64. With this set-up a reduction of budded baculovirus to less than 10% could be achieved [15,16]. Of note, this system is not versatile as it can only be used in combination with engineered insect cell lines, which are generally tedious to generate and are frequently instable and/or associated with low productivity [17,18]. Thus, stably engineered insect cell lines have, to the best of our knowledge, up to now not reached the biopharmaceutical industry.

To surmount these difficulties, we designed a virus-based CRISPR/Cas9 knock-out strategy in insect cells with the aim to reduce virus progeny in expression supernatants. The system can be used in any insect cell lines supporting AcMNPV replication, such as Sf9 or HighFiveTM, without the need for cell engineering. The platform described is based on co-infection with two engineered baculoviruses, where one encodes the Cas9 nuclease and the other provides transcription of a sgRNA specific for a baculovirus essential gene. In this manner high titer virus stocks can be separately amplified and only upon co-infection of cells, gene editing can occur, production of budding essential proteins and viral budding is impaired. As targets we selected gp64 and vp80, which have been shown before to be indispensable for efficient virus budding [19,20]. With our experimental set-up we achieved a reduction in viral titer by more than 90% compared to the control. However, we also measured lower levels of overall eYFP fluorescence intensity, which served as recombinant model protein.

Methods

Cell culture

Sf9 cells (ATCC-CRL-1711) were maintained in serum-free HyClone SFM4 Insect medium (Cytiva) with L-Glutamine supplemented with 0.1% Kolliphor P188 (Sigma Aldrich). Cells, tested negative for mycoplasma, were cultured in Erlenmeyer shaking flasks at 110 rpm and 27°C.

Molecular cloning and virus generation

A pACEBac1gp64 promoter transfer plasmid was generated by exchanging the polyhedrin (polh) promoter on the pACEBac1 acceptor vector (Geneva Biotech) against the AcMNPV gp64 promoter. Briefly, pACEBac1 was digested with ClaI and BamHI restriction enzymes and the gp64 promoter amplicon—amplified from an isolated MultiBac bacmid–was digested with the same enzymes and ligated into the prepared vector. The Cas9 coding sequence (codon-optimized for expression in Drosophila) was PCR-amplified from the plasmid pBS-Hsp70-Cas9 (#46294, Addgene), digested with EcoRI and HindIII and was cloned into pACEBac1gp64 interjacent the gp64 promoter and SV40 terminator, yielding pACEBac1gp64-Cas9. The Cas9 sequence includes an N-terminal 3xFlag-tag (DYKDHDGDYKDHDIDYKDDDDK) and SV40 nuclear localisation signal (PKKKRKV) and a C-terminal nucleoplasmin nuclear localisation signal (KRPAATKKAGQAKKKK).

A pIDK donor vector (Geneva Biotech) harbouring the RNAIII U6-2 promoter was generated [21]. Briefly, the vector was digested with SpeI and XhoI to remove the AcMNPV p10 promoter. The U6-2 promoter was PCR-amplified from genomic DNA isolated from cultured Sf9 cells with primers [ATGATGATGACTAGTAATATACATACACATTTTATTGAAAATCAC; ATGATGATGCTCGAGACTTGCCAAGGCAAA], SpeI/XhoI-digested and was ligated into the digested pIDK vector to yield pIDK-Sf9U6-2. Then further, a pACEBac1-Sf9U6-2 vector was generated by exchanging the polh promoter with the Sf9U6-2 promoter. Briefly pACEBac1 was digested with ClaI and XbaI, the U6-2 promoter was amplified from pIDK-Sf9U6-2, the amplicon was digested with the same enzymes and ligated with the digested vector, resulting in pACEBac1-Sf9U6-2.

SgRNAs, targeting AcMNPV gp64 or vp80, were designed with the Benchling CRISPR Guide RNA design tool (https://www.benchling.com). For each viral gene two sgRNA sequences were selected based on on-target score and off-target score setting the Spodoptera frugiperda genome as off-target genome (Table 1). SgRNA sequences were ordered as synthetic gene fragments (gblocks) from Integrated DNA Technologies (IDT). SgRNA sequences were PCR-amplified, digested with XbaI and AvrII and ligated into pACEBac1-Sf9U6-2, previously digested with the same enzymes. The empty pACEBac1-Sf9U6-2 vector served as control in all experiments. All generated plasmids were sequenced by sanger sequencing.

Table 1. Protospacer sequences of sgRNAs (5’-3’).

sgRNA Protospacer sequence (5’-3’) PAM Strand
sgRNA gp64 1 GGTTAGAGCCAAGTACACAG AGG Template
sgRNA gp64 2 GGAAATCACCATCGTGGAGA CGG Template
sgRNA vp80 1 GGGTCGCTGGATGTTACCCG CGG Nontemplate
sgRNA vp80 2 GGACACGTTAGAGGTAATGT TGG Template

Recombinant baculoviruses (rBVs) were generated by transforming pACEBac1 plasmid derivatives into DH10EMBacY cells (Geneva Biotec) that carry an eYFP expression cassette under control of the polh promoter. Bacmid-DNA was isolated and transfected into Sf9 cells using FuGene HD transfection reagent (Promega) according to the manufacturer’s instructions. Recombinant baculoviruses were amplified to P2 stocks in Sf9 cells. This yielded one rBV that carried a Cas9 expression cassette (Ac-Cas9), four rBVs that enabled transcription of two gp64 or vp80 sgRNAs, respectively (Ac-sgRNA gp64 1; Ac-sgRNA gp64 2; Ac-sgRNA vp80 1; Ac-sgRNA vp80 2) and one pACEBac-Sf9U6-2 virus that served as control (Ac-empty). Viral titers were evaluated by a TCID50 endpoint dilution assay.

Co-infections

Co-infections were carried out in 6-well tissue culture plates. Cells were seeded at a density of 1x106 cells/well in cell culture medium and were co-infected with Ac-Cas9 and one of the four Ac-sgRNA viruses or Ac-empty, respectively. Appropriate volumes of virus solutions for co-infections were premixed in 1 mL medium to reach a final multiplicity of infection (MOI) of 5 plaque forming units (PFU)/cell for Ac-sgRNA gp64 1, Ac-sgRNA gp64 2, Ac-sgRNA vp80 1, Ac-sgRNA vp80 2 or Ac-empty and a final MOI of 1 or 5 PFU/cell for Ac-Cas9. The initial medium was removed and premixed virus solutions were added dropwise to the cells. After 1 h of incubation at 27°C, the virus inoculum was removed, cells were washed twice with medium, before 1 mL fresh medium was added dropwise to each well and plates incubated at 27°C for 72 h. All experiments were performed in three biological replicates.

Endpoint dilution assay

Baculovirus titers were determined by TCID50. Briefly, 100 μL Sf9 cells/well, at a density of 4x105 cells/mL were seeded in 96-well plates. Virus suspensions were 5-fold serially diluted and 20 μL of each dilution was added to the cells in 8 replicates. After 5 days of incubation at 27°C, fluorescence was evaluated with a Leica Fluorescence microscope. TCID50 units were calculated using a modified equation from Reed an Muench and converted to PFU/mL using a Poisson distribution-derived factor [22]. Statistical significance was determined by one-way ANOVA.

Plaque assay

Additionally, viral titers were evaluated by standard plaque assay. Briefly, Sf9 cells were seeded in 6-well plates at a density of 1x106 cells/well. Supernatants from co-infections were 10-fold serially diluted in duplicates and 500 μL of each virus dilution was added to the cells. Plates were incubated for 1 h at 27°C, before the viral inoculum was removed and wells were overlaid with 2 mL of cell culture medium supplemented with 1% low melting temperature agarose (Sigma-Aldrich), 10% FBS (Gibco) and 1 x Antibiotic-antimycotic mix (Gibco). After incubation for 6 days at 27°C in a humid environment, plaque assays were stained with 1 mg/mL MTT (Sigma-Aldrich), plaques were counted, and the titer determined as PFU/mL. One-way ANOVA was applied to evaluate statistical significance.

Flow cytometry

Three days post co-infection, cells were pelleted (500 x g, 5 min), washed in 800 μL PBS, recentrifuged at 500 x g for 5 min, and resuspended in 500 μL PBS. eYFP fluorescence intensity was measured utilizing a CytoFLEX S flow cytometer (Beckman) and data analysis was performed with the Kaluza 2.1 software (Beckman). The overall eYFP fluorescence intensity (sum of intensity) was calculated by multiplying the number of fluorescent cells with the arithmetic mean of the fluorescence intensity.

qPCR

Total DNA was extracted from co-infected cells utilizing the monarch genomic DNA isolation kit (Neb) according to the manufacturer’s instructions. qPCR was performed with the Luna Universal qPCR Master Mix (Neb) according to the protocol provided by the manufacturer. For quantification of relative eYFP DNA levels gene specific primers were used [GGCACAAGCTGGAGTACAAC; AGTTCACCTTGATGCCGTTC] [23]. For quantification of relative vp39 DNA levels gene specific primers were designed with the Genescript Real-time PCR (TaqMan) Primer and Probes Design Tool [ACTTGCAAATCGACACGGAGGA; AGCTCACGTGTGTCGCCTTC]. Ecdysoneless (ECD), previously proven suitable as reference gene during baculovirus infection of Spodoptera frugiperda cells, served as internal reference [GCCGTATCCAAAGGATGACA; TGGTGACGGCCAAAGGAA] [24]. 20 μL qPCR reactions consisted of 10 μL Luna Universal qPCR Master Mix, 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 1 ng DNA template and nuclease-free water (to 20 μL). qPCR was conducted on a C1000 Themal Clycler with CFX96 Real-Time PCR Detection System (Bio-Rad) under the following cycling conditions: initial denaturation at 95°C for 60 sec, followed by 40 cycles of denaturation at 95°C for 15 sec, elongation at 60°C for 30 sec and a subsequent plate read. Melt curve analysis were performed to verify specific amplification. Relative levels of eYFP and vp39 DNA were determined with the 2ΔΔcq method [25]. Statistical significance was evaluated via Student’s t-test.

Results

Set-up of the inducible knockout system

Generating and maintaining stable insect cell lines can be demanding and approaches for reducing baculovirus particle formation that rely on stably engineered helper cell lines are often accompanied by loss of productivity [9,10]. Therefore, we develop a fast and versatile baculovirus-based knockout system aimed at impeding baculovirus formation and thereby reducing the viral burden in expression supernatants. Our approach relies on co-infecting insect cells with two distinct recombinant baculovirus vectors (Fig 1), one of which comprising a Cas9 expression cassette containing the AcMNPV gp64 promoter (Ac-Cas9) and the second vector allowing for the transcription of sgRNAs under control of a constitutive Sf9 polymerase III promoter (Ac-sgRNA). For expression of Cas9 the gp64 promoter was chosen, since as compared to expression from a very late baculovirus promoter such as the polh promoter, it leads to earlier availability of the Cas9 nuclease at sufficiently high levels [26]. As targets we selected gp64 and vp80, which have both been shown to be required for efficient baculovirus budding [19,20]. GP64 is the baculovirus major envelope glycoprotein and essential for cell entry as well as virus egress [27,28]. Its expression peaks twice, moderately strong early and stronger late during the viral life cycle [29]. The baculovirus minor capsid protein VP80 is transcribed late in virus replication and was shown to be indispensable for migration of nucleocapsids to the cellular periphery and consequently budded virus propagation [20]. For knockout, we designed and tested two sgRNAs for each gene. Our system, employing a co-infection strategy brings along the advantage, that rBVs may be individually amplified to high-titer virus stocks and the CRISPR/Cas9 machinery only comes into action once cells are infected with both viruses simultaneously.

Fig 1. Set-up of the co-infection based inducible knockout system.

Fig 1

The inducible knockout system is based on co-infection with two viral vectors, the first one carrying the sequence for the expression of the Cas9 nuclease under control of the baculoviral gp64 promoter and the second one carrying the sequence for the expression of the sgRNA under control of an Sf9-U6-promoter. Additionally, all viral vectors bring along a sequence for expressing the model protein eYFP under control of the very late baculovirus polyhedrin (polh) promoter.

Co-infection impacts baculovirus replication

First, we evaluated the efficiency of our system to knockout baculoviral genes and thereby reduce virus budding. In an initial screening experiment, Sf9 cells were co-infected with the two baculoviruses at two different MOI-combinations, but at constant volumes: While Ac-sgRNA gp64 1, Ac- sgRNA vp80 1 or the control virus Ac-empty were added at MOI 5 in all experiments, cells were co-infected with Ac-Cas9 at MOI 1 or MOI 5, respectively. The viral titers were determined 72 h post infection (hpi) via TCID50. As shown in Fig 2A, viral titers were comparable (1.1x107-3.1x107 PFU/mL) when adding the viruses at the MOI combination of 5–1. Yet, when adding both viruses at MOI 5 we observed a significant titer reduction (about 90%) after co-infection with all Ac-Cas9 –Ac-sgRNA combinations as compared to the control (Fig 2B). Thus, for all upcoming experiments, we only considered the MOI combination of 5–5.

Fig 2. Baculovirus titers after co-infection.

Fig 2

(A) Infectious virus titer of supernatants co-infected with Ac-sgRNA or Ac-empty at MOI 5 and Ac-Cas9 at MOI 1, determined via TCID50 (B) Infectious virus titer of supernatants co-infected with Ac-sgRNA or Ac-empty and Ac-Cas9 both at MOI 5, determined via TCID50 (C) Infectious virus titer of supernatants co-infected with Ac-sgRNA or Ac-empty and Ac-Cas9 both at MOI 5, measured by plaque assay. ** p < 0.01; *** p < 0.001; **** p < 0.0001.

We then further included Ac-sgRNA gp64 2 and Ac-sgRNA vp80 2 into our analyses. Co-infection with Ac-sgRNA vp80 2 also significantly lowered the viral titer by around 85%, while the reduction with Ac-sgRNA gp64 2 was the least pronounced (by ~60%) (Fig 2B). Plaque assays were performed to confirm these results by an ortholog method. There, Ac-sgRNA gp64 1, Ac-sgRNA vp80 1 and Ac-sgRNA vp80 2 proved to be highly efficient in reducing baculovirus budding, resulting in a baculovirus titer reduction of over 90%. The co-infection with Ac-sgRNA gp64 2 showed again the lowest efficiency, with a decline by around 80% (Fig 2C).

Co-infection influences recombinant protein production

All recombinant baculovirus used for co-infection additionally contained an expression cassette for eYFP under control of the very late baculoviral polyhedrin promoter, usually exploited for recombinant protein production (Fig 1). Therefore, we next analysed whether the knockout and titer reduction would influence very late gene expression and thus, recombinant protein production, using eYFP as a model protein. Sf9 cells co-infected with Ac-Cas9 and one of the Ac-sgRNA viruses or the control virus Ac-empty were analysed for their overall eYFP fluorescence intensity via flow cytometry 72 hpi. As shown in Fig 3A, for all co-infections of Ac-Cas9 with a rBV supporting sgRNA transcription, we saw a reduction in the sum of fluorescence intensity compared to the co-infection with the control virus. The reduction in overall fluorescence intensity was most pronounced for co-infections with the two viruses encoding the baculovirus gp64 sgRNAs (-60-70%). In contrast, when vp80 was targeted, the overall eYFP fluorescence intensity was only reduced by about 40–50%. When splitting up the signal of overall fluorescence intensity into percentage of eYFP positive cells and eYFP intensity, we saw different effects for the different knockout setups. For Ac-sgRNA gp64 1 it was the number of eYFP positive cells that was greatly reduced, while for Ac-sgRNA gp64 2 both number and signal intensity were decreased. The co-infections with Ac-sgRNA vp80 1 and Ac-sgRNA vp80 2 on the other hand, led mainly to a reduction in fluorescence intensity, while the number of eYFP positive cells, remained roughly the same as the one of the co-infection with the control (Fig 3B and 3C).

Fig 3. eYFP fluorescence intensity measured by flow cytometry.

Fig 3

(A) Overall eYFP fluorescence intensity (sum of intensity) of cells co-infected with Ac-sgRNA and Ac-Cas9 compared to a co-infection with the control virus (Ac-empty and Ac-Cas9) (B) Number of eYFP positive cells after co-infection with Ac-sgRNA and Ac-Cas9 compared to a co-infection with the control virus (Ac-empty and Ac-Cas9) (C) eYFP fluorescence intensity of cells co-infected with Ac-sgRNA and Ac-Cas9 compared to a co-infection with the control virus (Ac-empty and Ac-Cas9).

qPCR reveals lower levels of viral DNA in cells

When co-infecting Sf9 cells we determined a reduction in baculovirus titer, but also in very late gene expression. In order to investigate whether the observed effects might be caused by lower levels of viral DNA inside cells, we determined the relative DNA levels of eYFP and baculoviral vp39 capsid gene. Sf9 cells were therefore co-infected with Ac-Cas9 and Ac-sgRNA vp80 1 or Ac-empty, both at MOI 5. We chose Ac-sgRNA vp80 1 for the experiment, since it looked the most promising from previous results (highest titer reduction, lowest eYFP signal loss). Cellular DNA was isolated 72 hpi and relative DNA levels were determined on basis of the eYFP and vp39 gene, respectively by qPCR utilizing the 2ΔΔcq method. Fig 4 shows the ΔΔcq and matching fold change values resulting from a comparison of Δcq values from the co-infection with the control virus Ac-empty (ΔΔcq = 0; fold change = -1). Co-infection with Ac-sgRNA vp80 1 lead to a fold change of -2.2 of eYFP DNA and -2.3 vp39 DNA levels respectively, confirming a reduction of viral DNA 72 h post co-infection with the virus supporting sgRNA expression.

Fig 4. Relative viral DNA levels determined by qPCR.

Fig 4

ΔΔcq and corresponding fold change values of eYFP DNA and vp39 DNA after co-infection with Ac-sgRNA vp80 1 and Ac-Cas9 compared to co-infection with Ac-empty and Ac-Cas9. ** p < 0.01.

Discussion

In this study we developed an inducible knockout platform in insect cells, based on CRISPR/Cas9 and co-infection, utilizing solely baculoviruses as the carrier of recombinant sequences, omitting the need for cumbersome cell engineering. We showed that a co-infection where one virus brings along the sequence for the expression of the Cas9 nuclease and the other one the sequence of the sgRNA can reduce baculovirus titers by over 90%, when either gp64 or vp80 are targeted for knockout. However, the phenomenon only comes into effect once both viruses are added at high MOI (MOI 5). Those data are consistent with previous studies, showing that during infections with multiple viral vectors utilizing the right MOI combination is crucial in order to reach cells with all virus constructs [30,31].

In total, we tested four different sgRNAs targeting either gp64 or vp80, which had varying efficiencies regarding titer reduction, supporting an important role of sgRNA design [32].

We further evaluated the effect of co-infection and titer reduction on recombinant protein production utilizing eYFP as a model protein. We saw a marked reduction in overall eYFP fluorescence intensity (by ~60–70%) when gp64 was targeted for silencing. When vp80 was targeted however, the reduction was to a much lower extent (by ~40–50%). Knockout of gp64 and vp80 in previous studies did not influence very late gene expression [9,10,16]. When performing qPCR, we determined lower levels of eYFP and vp39 DNA upon co-infection of cells with the Ac-sgRNA vp80 1 virus compared to the control co-infection with Ac-empty. Whether this reduction in genome copy number is due to a hampered secondary infection or a degradation of baculovirus genomes after Cas9 cleavage can only be speculated. Statistically, when infected at a high MOI such as 5 PFU/cell, essentially all cells should be infected synchronously. However, the reduction in virus propagation cannot rule out a decrease in secondary infections. Nevertheless, lower gene dosage and protein expression is not expected to be caused by fewer secondary infections. Degradation of linearized baculovirus DNA can also not be excluded. Although, CRISPR/Cas9 is nowadays a well-established tool for genome editing in various organisms, it has only been adapted for application within the baculovirus/insect cell expression system recently [33,34]. In eukaryotic cells, usually once DNA is cut by the CRISPR/Cas9 machinery it is repaired by cellular repair mechanisms, that however are error-prone often resulting in insertions or deletions and ultimately loss of function mutations [35]. In our study for the first time, both, Cas9 and sgRNA are delivered via baculovirus infection. The host machinery is shut down shortly after virus infection and whether the baculovirus encoded DNA polymerase is sufficient to repair after Cas9-cleavage is not known [36]. Linear baculovirus DNA within cells is fairly unstable and if repair mechanisms are impaired by virus infection or not available, less viral DNA is present resulting in reduced levels of baculovirus in the supernatant, but also lower levels of eYFP that can be transcribed and translated into protein and thus, less fluorescence signal is being detected. However, elucidation of the mechanism of Cas9 cleavage and repair of baculovirus DNA will help to clarify. Further experiments would be needed to explain the observed difference in the degree of signal reduction between targeting gp64 and vp80. In the case of gp64 there was a large population of eYFP-negative cells, however we do not think that this is due to technical limitations or addition of an inadequate amount of virus. Although, nucleotide sequences of gp64 and eYFP do not show levels of similarity, off-target effect of sgRNAs cannot be ruled out, as well as differences in binding efficiency of the sgRNAs.

Overall, we here describe a novel inducible knockout system in insect cells, that has the potential to markedly reduce the burden of co-formed baculovirus particles in expression supernatants, however effects recombinant protein production as well. Previous attempts in reducing viral particle formation, especially deletion of budding-essential genes gp64 and vp80 from the virus genome led to an even greater reduction in baculovirus titer as compared to our approach (~90% vs single cell infections). However, the need for helper cell lines to generate high titer viruses for production, was accompanied by a great loss in productivity [9,10,28]. Bruder et al., recently reported a system based on CRISPR/Cas9 as well, where they showed a titer reduction by more than 90%, without effecting recombinant protein yield. However, with their platform again a considerable amount of budded virus is still present, similar to what we have observed in our study [16]. The reason behind this might be that when the time point is reached where enough sgRNA, and in our case Cas9 are present and may act in the system, already sufficient viral proteins have been generated to drive virus budding. Additionally, the amount of generated Cas9 and sgRNA might not be enough to meet the amount of virus DNA that is produced during virus replication; hence a certain quantity of budded virus is still found in the supernatant.

While our approach led to a sufficiently reduced baculovirus titer that would facilitate downstream processing, it is accompanied by a loss in productivity, rendering application in industry uneconomic. Despite the vast number of approaches that have been investigated, none has succeeded in completely diminishing baculovirus budding without interfering with productivity. Future studies and innovative engineering strategies together with advances in separation techniques will be necessary to lower costs and timeframes and further improve recombinant protein production utilizing the baculovirus/insect cell expression system.

Conclusion

In this study we describe a novel inducible knockout platform in insect cells. Our system is based on co-infection with two viral vectors, one carrying the Cas9-sequence and the other one bringing along the sgRNA sequence. Knockout can only occur once cells are co-infected with both viruses and therefore, high titer viruses can be raised as long as both constructs are kept apart from each other. With our system, when targeting baculovirus gp64 and vp80, we saw a titer reduction of 58–94%. However, we also observed lower levels of recombinant protein as shown by the model protein eYFP, where the overall eYFP fluorescence intensity was diminished by 40–70%. To conclude, our platform enables baculoviral titer reductions of over 90% without the need of helper cells lines, however, it does not allow for an unimpaired recombinant protein production, that is necessary to facilitate downstream processing at large scale. Since none of the proposed strategies up to now does, new innovative approaches will be necessary, to ultimately further improve biopharmaceutical production employing the baculovirus insect cell expression system.

Supporting information

S1 File. Dataset.

(XLSX)

Acknowledgments

The authors would like to thank Anna-Maria Otte for help with cloning. This project was supported by EQ-BOKU VIBT GmbH and the BOKU Core Facility Biomolecular & Cellular Analysis.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was funded by the Austrian Science Fund (FWF Project W1224—Doctoral Program on Biomolecular Technology of Proteins—BioToP).

References

  • 1.Pidre ML, Arrías PN, Amorós Morales LC, Romanowski V. The Magic Staff: A Comprehensive Overview of Baculovirus-Based Technologies Applied to Human and Animal Health. Viruses. 2022;15(1). Epub 20221228. doi: 10.3390/v15010080 ; PubMed Central PMCID: PMC9863858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Felberbaum RS. The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors. Biotechnol J. 2015;10(5):702–14. Epub 20150320. doi: 10.1002/biot.201400438 ; PubMed Central PMCID: PMC7159335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Krammer F, Grabherr R. Alternative Influenza Vaccines Made by Insect Cells. Trends in molecular medicine. 2010;16(7). doi: 10.1016/j.molmed.2010.05.002 . [DOI] [PubMed] [Google Scholar]
  • 4.Reiter K, Pereira Aguilar P, Grammelhofer D, Joseph J, Steppert P, Jungbauer A. Separation of influenza virus-like particles from baculovirus by polymer-grafted anion exchanger. J Sep Sci. 2020;43(12):2270–8. Epub 20200430. doi: 10.1002/jssc.201901215 ; PubMed Central PMCID: PMC7318652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Matilainen H, Rinne J, Gilbert L, Marjomäki V, Reunanen H, Oker-Blom C. Baculovirus entry into human hepatoma cells. J Virol. 2005;79(24):15452–9. doi: 10.1128/JVI.79.24.15452-15459.2005 ; PubMed Central PMCID: PMC1316037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Margine I, Martinez-Gil L, Chou YY, Krammer F. Residual baculovirus in insect cell-derived influenza virus-like particle preparations enhances immunogenicity. PLoS One. 2012;7(12):e51559. Epub 20121207. doi: 10.1371/journal.pone.0051559 ; PubMed Central PMCID: PMC3517492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Klausberger M, Wilde M, Palmberger D, Hai R, Albrecht RA, Margine I, et al. One-shot vaccination with an insect cell-derived low-dose influenza A H7 virus-like particle preparation protects mice against H7N9 challenge. Vaccine. 2014;32(3):355–62. Epub 2013/11/23. doi: 10.1016/j.vaccine.2013.11.036 ; PubMed Central PMCID: PMC3906608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vicente T, Roldao A, Peixoto C, Carrondo MJ, Alves PM. Large-scale production and purification of VLP-based vaccines. J Invertebr Pathol. 2011;107 Suppl:S42–8. Epub 2011/08/04. doi: 10.1016/j.jip.2011.05.004 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chaves L, Ribeiro B, Blissard G. Production of GP64-free Virus-Like Particles From Baculovirus-Infected Insect Cells. The Journal of general virology. 2018;99(2). doi: 10.1099/jgv.0.001002 . [DOI] [PubMed] [Google Scholar]
  • 10.Marek M, van Oers MM, Devaraj FF, Vlak JM, Merten OW. Engineering of baculovirus vectors for the manufacture of virion-free biopharmaceuticals. Biotechnol Bioeng. 2011;108(5):1056–67. Epub 2011/03/31. doi: 10.1002/bit.23028 . [DOI] [PubMed] [Google Scholar]
  • 11.Lee HS, Lee HY, Kim YJ, Jung HD, Choi KJ, Yang JM, et al. Small interfering (Si) RNA mediated baculovirus replication reduction without affecting target gene expression. Virus Res. 2015;199:68–76. Epub 2015/01/30. doi: 10.1016/j.virusres.2015.01.015 . [DOI] [PubMed] [Google Scholar]
  • 12.Huang Y, Deng F, Hu Z, Vlak JM, Wang H. Baculovirus-mediated gene silencing in insect cells using intracellularly produced long double-stranded RNA. J Biotechnol. 2007;128(2):226–36. Epub 2006/11/23. doi: 10.1016/j.jbiotec.2006.09.016 . [DOI] [PubMed] [Google Scholar]
  • 13.Dias MM, Vidigal J, Sequeira DP, Alves PM, Teixeira AP, Roldão A. Insect High Five™ cell line development using site-specific flipase recombination technology. G3 (Bethesda). 2021;11(8). doi: 10.1093/g3journal/jkab166 ; PubMed Central PMCID: PMC8763235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fernandes B, Vidigal J, Correia R, Carrondo MJT, Alves PM, Teixeira AP, et al. Adaptive laboratory evolution of stable insect cell lines for improved HIV-Gag VLPs production. J Biotechnol. 2020;307:139–47. Epub 20191104. doi: 10.1016/j.jbiotec.2019.10.004 . [DOI] [PubMed] [Google Scholar]
  • 15.Bruder MR, Walji SD, Aucoin MG. Comparison of CRISPR-Cas9 Tools for Transcriptional Repression and Gene Disruption in the BEVS. Viruses. 2021;13(10). Epub 20210924. doi: 10.3390/v13101925 ; PubMed Central PMCID: PMC8541072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bruder MR, Aucoin MG. Evaluation of Virus-Free Manufacture of Recombinant Proteins Using CRISPR-Mediated Gene Disruption in Baculovirus-Infected Insect Cells. Vaccines (Basel). 2023;11(2). Epub 20230119. doi: 10.3390/vaccines11020225 ; PubMed Central PMCID: PMC9966935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hu D, Qian J, Zhang T, Yu Y, Xu Z, Zhang Y, et al. φC31 -Mediated Cassette Exchange in Sf9 Insect Cells for Stable Expression. Biotechnol J. 2023:e2200557. Epub 20230404. doi: 10.1002/biot.202200557 . [DOI] [PubMed] [Google Scholar]
  • 18.Fernandes B, Correia R, Sousa M, Carrondo MJT, Alves PM, Roldão A. Integrating high cell density cultures with adapted laboratory evolution for improved Gag-HA virus-like particles production in stable insect cell lines. Biotechnol Bioeng. 2021;118(7):2536–47. Epub 20210408. doi: 10.1002/bit.27766 . [DOI] [PubMed] [Google Scholar]
  • 19.Oomens AG, Blissard GW. Requirement for GP64 to drive efficient budding of Autographa californica multicapsid nucleopolyhedrovirus. Virology. 1999;254(2):297–314. Epub 1999/02/13. doi: 10.1006/viro.1998.9523 . [DOI] [PubMed] [Google Scholar]
  • 20.Marek M, Merten OW, Galibert L, Vlak JM, van Oers MM. Baculovirus VP80 protein and the F-actin cytoskeleton interact and connect the viral replication factory with the nuclear periphery. J Virol. 2011;85(11):5350–62. Epub 2011/04/01. doi: 10.1128/JVI.00035-11 ; PubMed Central PMCID: PMC3094977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Koehler C, Sauter PF, Wawryszyn M, Girona GE, Gupta K, Landry JJ, et al. Genetic code expansion for multiprotein complex engineering. Nat Methods. 2016;13(12):997–1000. Epub 20161017. doi: 10.1038/nmeth.4032 . [DOI] [PubMed] [Google Scholar]
  • 22.Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene 1938. p. 493–7. [Google Scholar]
  • 23.Koczka K, Ernst W, Palmberger D, Klausberger M, Nika L, Grabherr R. Development of a Dual-Vector System Utilizing MicroRNA Mimics of the Autographa californica miR-1 for an Inducible Knockdown in Insect Cells. Int J Mol Sci. 2019;20(3). Epub 2019/01/30. doi: 10.3390/ijms20030533 ; PubMed Central PMCID: PMC6387257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Salem TZ, Allam WR, Thiem SM. Verifying the stability of selected genes for normalization in Q PCR experiments of Spodoptera frugiperda cells during AcMNPV infection. PLoS One. 2014;9(10):e108516. Epub 20141014. doi: 10.1371/journal.pone.0108516 ; PubMed Central PMCID: PMC4196776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. Epub 2008/06/13. doi: 10.1038/nprot.2008.73 . [DOI] [PubMed] [Google Scholar]
  • 26.Grose C, Putman Z, Esposito D. A review of alternative promoters for optimal recombinant protein expression in baculovirus-infected insect cells. Protein Expr Purif. 2021;186:105924. Epub 20210601. doi: 10.1016/j.pep.2021.105924 ; PubMed Central PMCID: PMC8266756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Blissard GW, Wenz JR. Baculovirus gp64 envelope glycoprotein is sufficient to mediate pH-dependent membrane fusion. J Virol. 1992;66(11):6829–35. Epub 1992/11/01. doi: 10.1128/JVI.66.11.6829-6835.1992 ; PubMed Central PMCID: PMC240187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Monsma SA, Oomens AG, Blissard GW. The GP64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. J Virol. 1996;70(7):4607–16. Epub 1996/07/01. doi: 10.1128/JVI.70.7.4607-4616.1996 ; PubMed Central PMCID: PMC190397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chen YR, Zhong S, Fei Z, Hashimoto Y, Xiang JZ, Zhang S, et al. The transcriptome of the baculovirus Autographa californica multiple nucleopolyhedrovirus in Trichoplusia ni cells. J Virol. 2013;87(11):6391–405. Epub 20130327. doi: 10.1128/JVI.00194-13 ; PubMed Central PMCID: PMC3648101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Vieira HL, Estêvão C, Roldão A, Peixoto CC, Sousa MF, Cruz PE, et al. Triple layered rotavirus VLP production: kinetics of vector replication, mRNA stability and recombinant protein production. J Biotechnol. 2005;120(1):72–82. Epub 20050714. doi: 10.1016/j.jbiotec.2005.03.026 . [DOI] [PubMed] [Google Scholar]
  • 31.Aucoin MG, Perrier M, Kamen AA. Production of adeno-associated viral vectors in insect cells using triple infection: optimization of baculovirus concentration ratios. Biotechnol Bioeng. 2006;95(6):1081–92. doi: 10.1002/bit.21069 . [DOI] [PubMed] [Google Scholar]
  • 32.Campenhout CV, Cabochette P, Veillard AC, Laczik M, Zelisko-Schmidt A, Sabatel C, et al. Guidelines for optimized gene knockout using CRISPR/Cas9. Biotechniques. 2019;66(6):295–302. Epub 20190501. doi: 10.2144/btn-2018-0187 . [DOI] [PubMed] [Google Scholar]
  • 33.Mabashi-Asazuma H, Jarvis DL. CRISPR-Cas9 vectors for genome editing and host engineering in the baculovirus-insect cell system. Proc Natl Acad Sci U S A. 2017;114(34):9068–73. Epub 20170807. doi: 10.1073/pnas.1705836114 ; PubMed Central PMCID: PMC5576809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pazmiño-Ibarra V, Mengual-Martí A, Targovnik AM, Herrero S. Improvement of baculovirus as protein expression vector and as biopesticide by CRISPR/Cas9 editing. Biotechnol Bioeng. 2019;116(11):2823–33. Epub 20190902. doi: 10.1002/bit.27139 . [DOI] [PubMed] [Google Scholar]
  • 35.Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281–308. Epub 20131024. doi: 10.1038/nprot.2013.143 ; PubMed Central PMCID: PMC3969860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Koczka K, Peters P, Ernst W, Himmelbauer H, Nika L, Grabherr R. Comparative transcriptome analysis of a Trichoplusia ni cell line reveals distinct host responses to intracellular and secreted protein products expressed by recombinant baculoviruses. Journal of biotechnology. 2018;270. doi: 10.1016/j.jbiotec.2018.02.001 . [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Dataset.

(XLSX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLOS ONE are provided here courtesy of PLOS

RESOURCES