. 2023 Jul 28;13:12282. doi: 10.1038/s41598-023-39447-1

Table 3.

List of the primers used in this study to amplify the targeted pathogens' fragments.

Pathogen	Target	Primer ID	Sequence (5ʹ → 3ʹ)	PCR product length (bp)	Total G+C content (%)
Brucella spp.	IS711	BruHRM_F	AAGCCGGATAGAAGGCTTGA	101	54.08
Brucella spp.	IS711	BruHRM_R	CTGCATGCTGTTGTCGATG	101	54.08
C. burnetii	IS1111	CoxHRM_F	AGGAGACACACCAACCGAGT	121	47.05
C. burnetii	IS1111	CoxHRM_R	GGTTGATGCTTATCGGGCTA	121	47.05
Leptospira spp.	LiPL32	LepHRM_F	CGGTTTAGTCGATGGAAACAA	77	43.22
Leptospira spp.	LiPL32	LepHRM_R	GAACTCCCATTTCAGCGATT	77	43.22
L. monocytogenes	ssrA	LisHRM_F	CGGTAACAGGCTTCCATTCA	93	42.86
L. monocytogenes	ssrA	LisHRM_R	GGGTCTCACTCTAAGTGGGCTA	93	42.86

The names and sequences of the primers designed, target genes, and the estimated PCR amplicon size and G+C content are presented.