Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | E. coli XL10-GOLD KanR Ultracompetent Cells | Agilent | 200317 | |
| Strain, strain background (Escherichia coli) | BL21 E. coli C41 (DE3) RIPL | PMID: 24876499 | C41 | |
| Strain, strain background (Spodoptera frugiperda) | Sf9 Insect Cells | Expression systems | 94-001S | |
| Strain, strain background (Escherichia coli) | E. coli DH10EMBacY Competent Cells | Geneva Biotech | DH10EMBacY | |
| Recombinant DNA reagent | pMultiBac-Gβ1/Gγ2 | PMID:34452907 | pOP737 | |
| Recombinant DNA reagent | pACEBac1-hsp110γ | PMID:34452907 | MR30 | |
| Recombinant DNA reagent | pMultiBac-hsp110γ-ssp101 | PMID:34452907 | MR22 | |
| Recombinant DNA reagent | pMultiBac-hsp110γ-mmp84 | PMID:34452907 | MR24 | |
| Recombinant DNA reagent | pFastBac HRas G12V | PMID:34452907 | BS9 | |
| Recombinant DNA reagent | biGBac hsp110γ/ybbr-hsp84 | PMID:36842083 | HP28 | |
| Recombinant DNA reagent | biGBac hsp110γ/ybbr-hsp101 | PMID:36842083 | HP29 | |
| Recombinant DNA reagent | his6-GST-PrescissionProtease-SNAP-RBD(K65E) | PMID:34452907 | pSH936 | |
| Recombinant DNA reagent | his6TEV-HRas(1-184aa) C118S, C181S | PMID:34452907 | pSH414 | |
| Recombinant DNA reagent | his6-G2, SNAP-G1 (DUAL FastBac) | PMID:34452907 | pSH651 | |
| Recombinant DNA reagent | pACEBAC-PKCβII (internal tev cleavage site) | This paper | pMR56 | |
| Recombinant DNA reagent | pFASTBac p110α | PMID: 28515318 | pOV1181 | |
| Recombinant DNA reagent | pFASTBac p110β | PMID: 28515318 | pOV1182 | |
| Recombinant DNA reagent | pFASTBac p110δ | PMID: 28515318 | pOV1183 | |
| Recombinant DNA reagent | pFASTBac p85β | This paper | EX21 | |
| Sequence-based reagent | Fwd primer for amplifying KD of PKCII | Sigma | MR51F |
GTATTTTCAGGGCgccggtaccACGA CCAACACTGTCTCCAAATTTG |
| Sequence-based reagent | Rvs primer for amplifying KD of PKCII | Sigma | MR51R | gactcgagcggccgcTTATAGCTCTT GACTTCGGGTTTTAAAAATTCAG |
| Sequence-based reagent | Fwd primer for amplifying N term of PKCII | Sigma | MR52F | CCATCACggatctggcggtagt ATGGCTGACCCGGCTGCG |
| Sequence-based reagent | Rvs primer for amplifying N term of PKCII | Sigma | MR52R | GCCCTGAAAATACAGGTTTTCCTTTTCTTCCGGGACCTTGGTTCCC |
| Sequence-based reagent | Fwd primer for adding stop codon to PKCII | Sigma | MR56F |
AGTCAAGAGCTAAgcgg ccgctcgagtctagagcctgc |
| Sequence-based reagent | Rvs primer for adding stop codon to PKCII | Sigma | MR56R | gactcgagcggccgcTTAGCTCTTGA CTTCGGGTTTTAAAAATTCAG |
| Commercial assay or kit | Transcreener ADP2 FI Assay (1000 Assay, 384 Well) | BellBrook Labs | 3013-1K | |
| Chemical compound, drug | Deuterium oxide 99.9% | Sigma | 151882 | |
| Chemical compound, drug | Guanosine 5′-diphosphate (GDP) sodium salt hydrate | Sigma | G7127-100MG | |
| Chemical compound, drug | Guanosine 5′-triphosphate (GTP) sodium salt hydrate | Sigma | G8877-250MG | |
| Chemical compound, drug | Sodium deoxycholate | Sigma | D6750 | |
| Chemical compound, drug | Polyoxyethylene (10) lauryl ether | Sigma | P9769 | |
| Chemical compound, drug | CHAPS, Molecular Biology Grade | EMD Millipore | 220201 | |
| Chemical compound, drug | Phosphatidylserine (Porcine Brain) | Avanti | 840032C | |
| Chemical compound, drug | Phosphatidylethanolamine (Egg yolk) | Sigma | P6386 | |
| Chemical compound, drug | Cholesterol | Sigma | 47,127U | |
| Chemical compound, drug | Phosphatidylcholine (Egg yolk) | Avanti | 840051C | |
| Chemical compound, drug | Phosphatidylinositol-4,5-bisphosphate (Porcine Brain) | Avanti | 840046 | |
| Chemical compound, drug | Sphingomyelin (Egg yolk) | Sigma | S0756 | |
| Chemical compound, drug | 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC) | Avanti | 850375C | |
| Chemical compound, drug | 1,2-Dioleoyl-sn-glycero-3-phospho-L-serine (18:1, DOPS) | Avanti | 840035C | |
| Chemical compound, drug | 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (18:1 MCC-PE) | Avanti | 780201C | |
| Chemical compound, drug | 10 mg/mL beta casein solution | Thermo Fisher | 37528 | |
| Chemical compound, drug | 10× PBS (pH 7.4) | Corning | 46-013CM | |
| Chemical compound, drug | glucose oxidase from Aspergillus niger (225 U/mg) | Biophoretics | B01357.02 | |
| Chemical compound, drug | Catalase | Sigma | C40-100MG Bovine Liver | |
| Chemical compound, drug | Trolox | Cayman Chemicals | 10011659 | |
| Chemical compound, drug | Dyomics 647 maleimide dye | Dyomics | 647P1-03 | |
| Chemical compound, drug | Coenzyme A | Sigma | C3019 | |
| Chemical compound, drug | Sulfuric acid | Sigma | 58105-2.5L-PC | |
| Software, algorithm | COOT-0.9.4.1 | CCP4 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ | |
| Software, algorithm | Phenix-1.19.1 | Open source | https://www.phenix-online.org/ | |
| Software, algorithm | PDBePISA (Proteins, Interfaces, Structures and Assemblies) | EMBL-EBI | https://www.ebi.ac.uk/pdbe/pisa/pistart.html | |
| Software, algorithm | ESPript 3.0 | Robert and Gouet, 2014 | https://espript.ibcp.fr | |
| Software, algorithm | HDExaminer | Sierra Analytics | http://massspec.com/hdexaminer | |
| Software, algorithm | GraphPad Prism 7 | GraphPad | https://www.graphpad.com | |
| Software, algorithm | PyMOL | Schroedinger | http://pymol.org | |
| Software, algorithm | Compass Data Analysis | Bruker | https://www.bruker.com | |
| Software, algorithm | ChimeraX | UCSF | https://www.rbvi.ucsf.edu/chimerax/ | |
| Software, algorithm | ImageJ/Fiji | ImageJ | https://imagej.net/software/fiji/ | |
| Software, algorithm | Nikon NIS elements | Nikon | https://www.microscope.healthcare.nikon.com/products/software/nis-elements | |
| Software, algorithm | cryoSPARC v.3.3.2 | Structura Biotechnology | https://cryosparc.com/ | |
| Other | Sf9 insect cells for expression | Expression Systems | 94–001S | Sf9 cell line used for protein expression (Methods) |
| Other | Insect cell media | Expression Systems | 96-001-01 | Sf9 cell media (Methods) |
| Other | Hellmanex III cleaning solution | Fisher | 14-385-864 | Cleaning solution for TIRF experiments (PMID:36842083) |
| Other | Six-well sticky-side chamber | IBIDI | 80608 | Side chamber used for TIRF experiments (Methods) |
| Other | C-Flat 2/2T grids | Electron Microscopy Sciences | CFT-223C | Grids used for EM studies (Methods) |
| Other | PDB coordinate file for p110γ-NB7 structure | PDB | 8DP0 | PDB to use for p110-NB7 structure |
| Other | EM density file for p110γ-NB7 complex | EMD | EMD-27627 | EM density file to use for p110-NB7 |
| Other | HDX-MS and phosphorylation proteomics data | PRIDE | PXD040765 | Database and number where HDX data was uploaded |