| Reagent/resource | Reference or source | Identifier or catalog number |
|---|---|---|
| Experimental models | ||
| Rosetta™(DE3) pLysS Competent Cells | Novagen | 70956 |
| https://www.emdmillipore.com/US/en/product/RosettaDE3-Competent-Cells-Novagen,EMD_BIO-70954 | ||
| H9 ES cells | WiCell, Madison WI | WA09 |
| RRID: CVCL_9773 | ||
| H9 ES cells + AAVS‐NGN2 | Ordureau et al (2020) | RRID: CVCL_C4EK |
| H9 ES PINK1−/− + AAVS‐NGN2 | Ordureau et al (2020) | RRID: CVCL_C4EM |
| H9 ES FBXO7−/− + AAVS‐NGN2 | This paper | RRID: CVCL_C4EN |
| HeLa HFT/TO‐PRKN | Ordureau et al (2014) | RRID: CVCL_C4EQ |
| HeLa HFT/TO‐PRKN PINK1−/− | Ordureau et al (2014) | RRID: CVCL_C4ES |
| HeLa HFT/TO‐PRKN FBXO7−/− | This paper | RRID: CVCL_C4ER |
| HEK293T | ATCC | RRID:CVCL_0063 |
| HEK293T FBXO7−/− | This paper | RRID: CVCL_C7U0 |
| Recombinant DNA | ||
| pET‐NLS‐Cas9‐6xHis | Zuris et al (2015); Addgene | Addgene #62934 |
| RRID:Addgene_62934 | ||
| gRNA_AAVS1‐T2 | Addgene | Addgene #41818 |
| RRID:Addgene_41818 | ||
| pAAVS1‐TRE3G‐NGN2 | Ordureau et al (2020) | N/A |
| px459 | Addgene | Addgene #62988; RRID:Addgene_62988 |
| hCAS9 plasmid | Addgene | Addgene #41815 |
| RRID:Addgene_41815 | ||
| pAC150‐PBLHL‐4xHS‐EF1a – mtx‐mKeimaXL | Ordureau et al (2020) | Dest vector: Addgene #48234 |
| RRID:Addgene_48234 | ||
| pCMV‐hyPBase – hyperactive piggyBac transposase | Yusa et al (2011) | https://www.sanger.ac.uk/form/Sanger_CloneRequests |
| psPAX2 | Addgene | Addgene #12260 |
| RRID:Addgene_12260 | ||
| pMD2.G | Addgene | Addgene #12259 |
| RRID:Addgene_12259 | ||
| pHAGE‐mt‐mKeima | Vargas et al (2019) | Addgene #131626 |
| RRID:Addgene_131626 | ||
| pHAGE‐GFP‐Parkin | Heo et al (2015) | N/A |
| pGEX4T1‐TEV‐HsFbxo7‐129‐398/HsSkp1 | This study | |
| pRSF1b‐His8‐TEV‐HsPI31‐1‐151 | This study | |
| pGEX4T1‐TEV‐HsCul1‐1‐410 | Hopf et al (2022) | https://pubmed.ncbi.nlm.nih.gov/35982156/ |
| Antibodies | ||
| Anti‐HSP60 | Abcam | ab128567 |
| RRID:AB_11145464 | ||
| Anti‐FBXO7 (D8L4E) | Cell Signaling Technology | 57981S |
| RRID:AB_2799536 | ||
| Anti‐Tomm20 | Abcam | ab186735 |
| RRID:AB_2889972 | ||
| Anti‐Phospho‐Ser65‐Ubiquitin | Cell Signaling Technology | 70973S |
| RRID:AB_2799795 | ||
| Anti‐beta‐Actin | Santa‐Cruz | sc‐69879 |
| RRID:AB_1119529 | ||
| Anti‐SQSTM | Abnova | H00008878‐M01 |
| RRID:AB_437085 | ||
| Anti‐FIP200 (D10D11) | Cell Signaling Technology | 12436S |
| RRID:AB_2797913 | ||
| Anti‐LC3B | Cell Signaling Technology | 2775S |
| RRID:AB_915950 | ||
| Anti‐DNA | Progen | 61014 |
| RRID:AB_1541137 | ||
| Anti‐PCNA (PC10) | Santa‐Cruz | Sc‐56; RRID:AB_628110 |
| Anti‐MiD51 / MIEF2 | ProteinTech | 20164‐1‐AP |
| RRID:AB_10639522 | ||
| Anti‐GFP (chicken) | Thermo Fisher Scientific | A10262 |
| RRID:AB_2534023 | ||
| Anti‐WIPI2 | BioRad | MCA5780GA |
| RRID:AB_10845951 | ||
| Anti‐Rabbit IgG (H+L), HRP Conjugate | Promega | W4011; RRID:AB_430833 |
| Anti‐Mouse IgG (H+L), HRP Conjugate | Promega | W4021; RRID:AB_430834 |
| Goat anti‐mouse Alexa488 | Thermo Fisher Scientific | A‐11001 |
| RRID:AB_2534069 | ||
| Goat anti‐chicken Alexa488 | Thermo Fisher Scientific | A11039 |
| RRID: AB_2534096 | ||
| Goat anti‐rabbit Alexa568 | Thermo Fisher Scientific | A‐11011 |
| RRID:AB_143157 | ||
| Goat anti‐rabbit Alexa647 | Thermo Fisher Scientific | A27040 |
| RRID:AB_2536101 | ||
| Oligonucleotides and sequence‐based reagents | ||
| Primers for 5′ AAVS junction PCR | 5′‐ctctaacgctgccgtctctc‐3′ and 5′‐tgggcttgtactcggtcatc‐3′ | N/A |
| Primers for 3′ AAVS junction PCR | 5′‐cacacaacatacgagccgga‐3′ and 5′‐accccgaagagtgagtttgc‐3′ | N/A |
| Primers for locus PCR add MiSeq Primers FBXO7 | 5′‐ tcctttttcagttagggcctagt‐3′ and 5′‐ atgtctgtgttttgcttgcagt‐3′ | N/A |
| FBXO7 for deletion sgRNA | ACCGATTCACTACAGAGCATGGG | N/A |
| Chemicals, enzymes and other reagents | ||
| Oligomycin A | Sigma‐Aldrich | 75351 |
| Antimycin A | Sigma‐Aldrich | A8674 |
| Bafilomycin A | Sigma‐Aldrich | B1793‐10mg |
| Gamitrinib TPP hexafluorophosphate (G‐TPP) | MedChemExpress | HY‐102007A |
| Dithiothreitol (DTT) | Gold Biotechnology | DTT25 |
| Trypsin | Promega | V511C |
| Lys‐C | Wako Chemicals | 129‐02541 |
| Urea | Sigma | U5378 |
| Formic Acid | Sigma‐Aldrich | 94318 |
| EPPS | Sigma‐Aldrich | E9502 |
| 2‐Chloroacetamide | Sigma‐Aldrich | C0267 |
| Adenosine 5′ triphosphate, disodium, trihydrate (ATP) | Thermo‐Fisher Scientific | 10326943 |
| TCEP | Gold Biotechnology | TCEP2 |
| PhosSTOP phosphatase inhibitor cocktail | Roche | 4906845001 |
| Recombinant SpCas9 | Zuris et al (2015); This paper | N/A |
| 100 × 21 mm Dish, Nunclon Delta | Thermo Fisher Scientific | 172931 |
| Nunc Cell‐Culture Treated 6‐well | Thermo Fisher Scientific | 140685 |
| Nunc Cell‐Culture Treated 12‐well | Thermo Fisher Scientific | 150628 |
| Corning Matrigel Matrix, Growth Factor Reduced | Corning | 354230 |
| Geltrex LDEV‐Free Reduced Growth Factor Basement Membrane Matrix | Thermo Fisher Scientific | A1413202 |
| DMEM/F12 | Thermo Fisher Scientific | 11330057 |
| Neurobasal | Thermo Fisher Scientific | 21103049 |
| NEAA | Life Technologies | 11140050 |
| GlutaMax | Life Technologies | 35050061 |
| N‐2 Supplement (100X) | Thermo Fisher Scientific | 17502048 |
| Neurotrophin‐3 | Peprotech | 450‐03 |
| Brain‐derived neurotrophic factor (BDNF) | Peprotech | 450‐02 |
| Cultrex 3D Culture Matrix Laminin I | R&D Systems | 3446‐005‐01 |
| B27 | Thermo Fisher Scientific | 17504001 |
| B‐27 Supplement (50X), minus antioxidants | Thermo Fisher Scientific | 10889038 |
| Y‐27632 Dihydrochloride (ROCK inhibitor) | PeproTech | 1293823 |
| Accutase | StemCell | 7920 |
| FGF3 | in‐house | N/A |
| Insulin Human | Sigma‐Aldrich | I9278‐5ML |
| TGF‐beta | PeproTech | 100‐21C |
| holo‐Transferrin human | Sigma‐Aldrich | T0665 |
| Sodium Bicarbonate | Sigma‐Aldrich | S5761‐500G |
| Sodium selenite | Sigma‐Aldrich | S5261‐10G |
| Doxycycline | Sigma‐Aldrich | D9891 |
| Puromycin | Gold Biotechnology | P‐600‐500 |
| Hygromycin B | Thermo Fisher Scientific | 10687010 |
| UltraPure 0.5M EDTA, pH 8.0 | Thermo Fisher Scientific | 15575020 |
| DMEM, High Glucose, Pyruvate | Thermo Fisher Scientific | 11995‐073 |
| Penicillin‐Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | 15140163 |
| GlutaMAX | Thermo Fisher Scientific | 35050061 |
| MEM NEAA | Thermo Fisher Scientific | 11140050 |
| Trypsin‐EDTA | Sigma | T4049‐100ML |
| PBS | Corning | 21‐031‐CV |
| OptiMEM I reduced serum media | Thermo Fisher Scientific | 31985062 |
| Cover Glasses | VWR | 16004‐308 |
| Marienfeld Precision cover glasses thickness No. 1.5H (tol. ± 5 μm) 18 × 18 mm | VWR | 107032 |
| 6 Well glass bottom plate with high performance #1.5 cover glass | Cellvis | P06‐1.5H‐N |
| 12 Well glass bottom plate with high performance #1.5 cover glass | Cellvis | P12‐1.5H‐N |
| 24 Well glass bottom plate with high performance #1.5 cover glass | Cellvis | P24‐1.5H‐N |
| 96 Well glass bottom plate with high performance #1.5 cover glass | Cellvis | P96‐1.5H‐N |
| 16% Paraformaldehyde, Elecron‐Mircoscopy Grade | Electron Microscopy Science | 15710 |
| Paraformaldehyde 3% Glutaraldehyde 0.35% in 0.1M Sodium Cacodylate, pH 7.4 | Electron Microscopy Science | 15949‐50 |
| DAPI (4',6‐Diamidino‐2‐Phenylindole, Dihydrochloride) | Thermo Fisher Scientific | D1306 |
| Hoechst33342 | Thermo Fisher Scientific | H1399 |
| DNA SPY555 | Spirochrome | N/A |
| Vectashield | Vector Laboratories | H‐1000‐10 |
| FluoroBrite DMEM | Thermo Fisher Scientific | A1896701 |
| Falcon® 5mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap, 25/Pack, 500/Case | Corning | 352235 |
| NuPAGE 8%, Bis‐Tris, 1.0 mm, Midi Protein Gel, 12+2‐well | Thermo Fisher Scientific | WG1001BOX |
| NuPAGE Novex® 4–12% Bis‐Tris Midi Protein Gels, 20 well | Thermo Fisher Scientific | WG1402BOX |
| NuPAGE Novex® 4–12% Bis‐Tris Midi Protein Gels, 26 well | Thermo Fisher Scientific | WG1403BOX |
| NuPAGE™ LDS Sample Buffer (4X) | Thermo Fisher Scientific | NP0008 |
| Precision Plus Protein™ Kaleidoscope™ Prestained Protein Standards | BioRad | 1610395 |
| Revert 700 Total Protein Stain Kits for Western Blot Normalization | LI‐COR | 926‐11016 |
| Immobilon‐P Membrane, PVDF, 0.45 μm, 26.5 cm × 3.75 m roll | EMD Millipore | IPVH00010 |
| Criterion™ Cell/Plate Blotter System | BioRad | 1656024 |
| Lipofectaime LTX | Thermo Fisher Scientific | 15338100 |
| cOmplete, EDTA‐free Protease Inhibitor Cocktail | Milipore Sigma | 11873580001 |
| FastBreak Buffer | Promega Inc | V8571 |
| GeneArt Precision gRNA Synthesis Kit | Thermo Fisher Scientific | A29377 |
| Pierce™ High pH Reversed‐Phase Peptide Fractionation Kit | Thermo Fisher Scientific | 84868 |
| Pierce™ BCA Protein Assay Kit | Thermo Fisher Scientific | 23227 |
| TMTpro 18plex Label Reagent | Thermo Fisher Scientific | A52045 |
| Software | ||
| Prism | GraphPad, v9.4.1 (Build 458) | https://www.graphpad.com/scientific-software/prism/ |
| RRID:SCR_002798 | ||
| MassPike, In‐house mass spectrometry data analysis software | Huttlin et al (2010) | N/A |
| Monocle | Rad et al (2021) | RRID:SCR_018685 |
| SEQUEST | Eng et al (1994) | https://proteomicsresource.washington.edu/protocols06/sequest.php |
| Perseus (v1.6.5) | Tyanova et al (2016) | http://www.perseus-framework.org |
| RRID:SCR_015753 | ||
| MitoCharta | Rath et al (2021) | MitoCarta (RRID:SCR_018165) |
| FiJi | ImageJ 1.53t30 | https://imagej.net/Fiji |
| RRID:SCR_002285 | ||
| CellProfiler (v.4.2.1) | Stirling et al (2021) | https://cellprofiler.org |
| RRID:SCR_007358 | ||
| ImageStudioLite | v5.2.5 | https://www.licor.com/bio/image-studio-lite/ |
| RRID:SCR_013715 | ||
| FlowJo | v10.7.2 | https://www.flowjo.com |
| RRID:SCR_008520 | ||
| NIS Elements | 5.21.3 (Build 1489) | https://www.microscope.healthcare.nikon.com/products/software/nis-elements |
| RRID:SCR_014329 | ||
| Imaris | Oxford Instruments, v9.7 | RRID:SCR_007370 |
| Illustrator (v26.2.1) | Adobe Inc. | RRID:SCR_010279 |
| Excel (v.4.2.0) | Microsoft Inc. | RRID:SCR_016137 |
| R (4.2.0)/RStudio (2022.07.01 Build 554) | https://www.rstudio.com/ | |
| RRID:SCR_000432 | ||
| library(tibble) | v3.1.8 | https://cran.r-project.org/web/packages/tibble/tibble.pdf |
| library(ggVennDiagram) | v1.2.0 | https://cran.r-project.org/web/packages/ggVennDiagram/readme/README.html#:~:text=ggVennDiagram%20maps%20the%20fill%20color,%3Dsample(genes%2C350)) |
| library(stringr) | v1.4.0 | RRID:SCR_022813 |
| library(dplyr) | v1.0.9 | RRID:SCR_016708 |
| library(ggsci) | v2.9 | https://github.com/nanxstats/ggsci |
| library(ggrepel) | v0.9.1 | RRID:SCR_017393 |
| library(ggplot2) | v3.3.6 | RRID:SCR_014601 |
| library(tidyverse) | v1.3.2 | RRID:SCR_019186 |
| library(timecourse) | V1.68.0 | RRID:SCR_000077 |
| UCSF ChimeraX | version 1.4.dev202201050842 (2022‐01‐05) | https://www.cgl.ucsf.edu/chimerax/ |
| RRID:SCR_015872 | ||
| Snapgene (v.5.1.7) | Dotmatics | https://snapgene.com |
| RRID:SCR_015052 | ||
| Other | ||
| Orbitrap Fusion Lumos Mass Spectrometer | ThermoFisher Scientific | IQLAAEGAAPFADBMBHQ |
| RRID:SCR_020562 | ||
| Orbitrap Eclipse Tribrid Mass Spectrometer | ThermoFisher Scientific | FSN04‐10000 |
| RRID:SCR_020559 | ||
| Easy‐nLC 1200 | ThermoFisher Scientific | LC140 |
| Aeris™ 2.6 μm PEPTIDE XB‐C18 100 Å 250 × 4.6 mm | Phenomenex | 00G‐4505‐E0 |
| Sep‐Pak C18 1cc Vac Cartridge, 50 mg | Waters | WAT054960 |
| SOLA HRP SPE Cartridge, 10 mg | Thermo Fisher Scientific | 60109‐001 |
| Empore™ SPE Disks C18 | 3M Bioanalytical Technologies | 2215 |
| Neon™ Transfection System | Thermo Fisher Scientific | MPK5000 |
| ChemiDoc MP imaging system | BioRad | 12003154 |
| RRID:SCR_019037 | ||
| Nikon Ti w/ Yokagawa CSU‐W1 spinning disk confocal | Nikon Corporation | https://www.microscope.healthcare.nikon.com/products/confocal-microscopes/csu-series/csu-w1 |
| Nikon Ti w/ Yokagawa CSU‐X1 spinning disk confocal | Nikon Corporation | https://www.microscope.healthcare.nikon.com/products/confocal-microscopes/csu-series/csu-x1 |
| DeltaVision OMX V4 | Applied Precision (GE Healthcare) | https://sim.hms.harvard.edu/tech-specs/ |
| Symphony A5 | BD Biosciences | https://www.bdbiosciences.com/en-us/instruments/research-instruments/research-cell-analyzers/facsymphony |
| Attune NxT | Thermo Fisher Scientific | https://www.thermofisher.com/ca/en/home/life-science/cell-analysis/flow-cytometry/flow-cytometers/attune-nxt-flow-cytometer.html |
| RRID:SCR_019590 | ||
| ÄKTApure system | GE Healthcare/Cytiva | https://www.cytivalifesciences.com/en/us/shop/chromatography/chromatography-systems/akta-pure-p-05844 |
| Superdex 200 Increase 10/300 GL column | Cytiva | https://www.cytivalifesciences.com/en/us/shop/chromatography/prepacked-columns/size-exclusion/hiload-superdex-200-pg-preparative-size-exclusion-chromatography-columns-p-06283?s_kwcid=AL!14612!3!614128999325!b!!g!!superdex%20200&dtid=ppc_google_17817864916_143232689001&ps_kw=superdex%20200&extcmp=cy22498-se-paid-hiload-superdex-200-sec-columns&adgrp=&gclid=EAIaIQobChMImrT2j_aD_gIVfWxvBB1AYgKqEAAYASAAEgKTbPD_BwE |
| Cat no: 28989336 | ||
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.