TMEM106B is a receptor mediating ACE2-independent SARS-CoV-2 cell entry

. 2023 Aug 3;186(16):3427–3442.e22. doi: 10.1016/j.cell.2023.06.005

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

Mouse anti double-stranded RNA (J2)	Scicons	Cat# 10010200; RRID: AB_2651015
Rabbit anti-SARS-CoV-2 Nucleocapsid	Rockland	Cat# 200-401-A50; RRID: AB_828403
Mouse anti-RSV F Synagis (Palivizumab)	Astra Zeneca	PC (product n°): 05000456067102; SN (series n°): 05503236717903
Mouse (humanized) anti-TMEM106B	Alector; this paper	Ab01 to Ab77
Mouse Anti-Human LAMP-1 (H4A3)	Santa Cruz Biotechnology	Cat# sc-20011; RRID: AB_626853
GAPDH (0411)	Santa Cruz Biotechnology	Cat# sc-47724; RRID: AB_627678
Human/Mouse/Rat/Hamster ACE-2 Antibody	R&D Systems	Cat# AF933; RRID: AB_355722
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody; Alexa Fluor™ 568	Thermo Fisher Scientific	Cat# A-11011; RRID: AB_143157
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody; Alexa Fluor™ 488	Thermo Fisher Scientific	Cat# A-11008; RRID: AB_143165
Goat anti-Human IgG (H+L) Cross-Adsorbed Secondary Antibody; Alexa Fluor™ 488	Thermo Fisher Scientific	Cat# A-11013; RRID: AB_2534080
Goat anti-Human IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568	Thermo Fisher Scientific	Cat# A-21090; RRID: AB_2535746
Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody; Alexa Fluor™ 488	Thermo Fisher Scientific	Cat# A-11029; RRID: AB_2534088
Alexa Fluor® 647 AffiniPure Goat Anti-Human IgG; F(ab')₂ fragment specific	Jackson Immuno Research	Cat# 109-605-006; RRID: AB_2337881
Anti-Mouse Secondary HRP Antibody	Protein Simple	Cat# 042-205; RRID: AB_2860576
Anti-Goat Secondary HRP Antibody	Protein Simple	Cat# 043-522-2; RRID:AB_2940933
Rabbit anti-Avi Tag antibody	R&D Systems	Cat# MAB10546; RRID: AB_2935823

Bacterial and virus strains

One Shot™ Stbl3™ Chemically Competent E. coli	Thermo Fisher Scientific	Cat# C737303
SARS-CoV-2 isolate SARS-CoV-2/Belgium/GHB-03021/2020	Boudewijns et al.⁶⁶	GenBank: MW368439
SARS-CoV-2 isolate SARS-CoV-2/Germany/BavPat1/2020	Christian Drosten	GenBank: MW368440
SARS-CoV-2 VOCα isolate hCoV-19/Belgium/rega-12211513/2020	Abdelnabi et al.⁶⁷	GISAID: EPI_ISL_791333
SARS-CoV-2 VOCβ isolate hCoV-19/Belgium/rega-1920/ 2021	Abdelnabi et al.⁶⁷	GISAID: EPI_ISL_896474
SARS-CoV-2 VOC omicron isolate hCoV-19/Belgium/rega-20174/2021	Johan Neyts; Abdelnabi et al.⁶⁸	GISAID: EPI_ISL_6794907
HCoV-229E	ATCC	Cat# VR-740
RSV strain Long	ATCC	Cat# VR-26

Biological samples

Hamster anti-SARS-CoV-2 serum	Kai Dallmeier and Johan Neyts	N/A

Chemicals, peptides, and recombinant proteins

Camostat mesylate	Tokyo Chemical Industry	Cat# C2977
E64d	Tokyo Chemical Industry	Cat# E1337
Remdesivir	ACROS Organics	Cat# 469411000
Heparin	Sigma-Aldrich	Cat# H4784
Cycloheximide	Sigma-Aldrich	Cat# 01810
Heparan sulfate	Galen Laboratory Supplies	Cat# GAG-HS01
CellBrite Fix 640	Biotium	Cat# 30089
DAPI	Thermo Fisher Scientific	Cat# 3571
Paraformaldehyde	Sigma-Aldrich	Cat# 252549
Triton-X100	Sigma-Aldrich	Cat# 93443
X-TremeGENE9 DNA Transfection Reagent	Merck Life sciences	Cat# 6365809001
Gentamycin	Sigma-Aldrich	Cat# 1397
Puromycin	Sigma-Aldrich	Cat# P8833
Hygromycin	Thermo Fisher Scientific	Cat# 10687010
Blasticidin	Thermo Fisher Scientific	Cat# A11139-03
Antibiotic Antimycotic 100x	Thermo Fisher Scientific	Cat# 15240062
Polybrene	Santa Cruz	Cat# sc-134220
Crystal violet	Sigma-Aldrich	Cat# C3886
Live/Dead Near-IR stain	Thermo Fisher Scientific	Cat# L34975
Kifunensine	Sigma-Aldrich	Cat# K1140; CAS# 109944-15-2
Strep-Tactin®XT 4Flow® resin	IBA Lifesiences	Cat# 2-5010-002
BXT buffer	IBA Lifesiences	Cat# 2-1042-025
HisTrap Excel	Sigma-Aldrich	Cat# GE29-0485-86
Endoglycosidase H (Endo Hf)	New England Biolabs	Cat# P0703S
Tris(2-carboxyethyl)phosphine hydrochloride (TCEP)	Fisher Scientific	Cat# 15780329; CAS 5961-85-3
Formic Acid	Fisher Scientific	Cat# A117-50; CAS 64-18-6
Acetonitrile	Fisher Scientific	Cat# 15684740; CAS 75-05-8
Leucine Enkephaline	Waters	Cat# 186006013
Gu-HCl	Sigma-Aldrich	Cat# G4505; CAS 50-01-1
Deuterium Oxide	Sigma-Aldrich	Cat# 151882; CAS 7789-20-0
HiLoad® 16/600 Superdex® 200 pg	Sigma-Aldrich	Cat# GE28-9893-35
n-octyl glucoside	Sigma-Aldrich	Cat#10634425001
Poly-L-ornithine	Sigma-Aldrich	Cat# P4957
Geltrex	Thermo Fisher Scientific	Cat# A1569601
Laminin	Sigma-Aldrich	Cat# L2020
RIPA lysis buffer	Sigma-Aldrich	Cat# R0278
Stabilized trimeric Belgium/GHB-03021 SARS-CoV-2 spike ectodomain	This paper	N/A
Monomeric Belgium/GHB-03021 S1	This paper	N/A
TMEM106B^LD	This paper	N/A
ACE2 ectodomain	Wrobel et al.⁴³	N/A
Wuhan-Hu-1 SARS-CoV-2 S1(1-530)	Rosa et al.⁶⁶	N/A
AviHis-TMEM106B^LD (AA118-274)	This paper	N/A

Critical commercial assays

QIAamp DNA mini kit	Qiagen	Cat# 51304
CloneAmp HiFi PCR premix	Takara	Cat# 639298
Nucleospin Gel and PCR Clean-up	Machery-Nagel	Cat# 740609.50
CellTiter 96 AQueous One Solution Cell Proliferation Assay	Promega	Cat# G1111
CellsDirect™ One-Step qRT-PCR Kit	Thermo Fisher Scientific	Cat# 11753100
SARS-CoV-2 N1+N2 Assay Kit	Qiagen	Cat# 222015
TaqMan™ Gene Expression Assay (FAM) actin beta	Thermo Fisher Scientific	Cat# 4331182 Assay ID: Hs01060665_g1
NEBuilder HiFi DNA Assembly kit	New England Biolabs	Cat# E5520S
In-Fusion HD Kit	Takara	Cat# ST0345
Clonacell-HY Hybridoma Kit	Stem Cell Technologies	Cat# 03800
Expi293™ Expression System Kit	Thermo Fisher Scientific	Cat# A14635

Deposited data

Crystal structure of TMEM106B^LD	Protein Data Bank	PDB: 8B7D
Cryo-EM map of the spike-TMEM106B complex obtained by global consensus refinement	EM Data Bank	EMDB: EMD-17169
Cryo-EM map of the RBD-TMEM106B complex obtained by local refinement	EM Data Bank	EMDB: EMD-17170

Experimental models: Cell lines

Human: HEK293T	Jason Moffat lab⁶⁹	N/A
African green monkey: Vero E6	ATCC	Cat# CRL-1586; RRID: CVCL_0574
Human: Huh-7	CSL	Cat# 300156; RRID: CVCL_0336
Human: HCT-116	ATCC	Cat# CCL-247origin; RRID: CVCL_0291
Human: NCI-H1975	ATCC	Cat# CRL-5908; RRID: CVCL_1511
Human: HEp-2	ATCC	Cat# CCL-23; RRID: CVCL_1906
Human: CME035	Frederik De Smet⁷⁰	NA
Human: CME036	Frederik De Smet⁷⁰	NA
Human: CME038	Frederik De Smet⁷⁰	NA
Human: iPSC-derived Astrocytes	Tempo Bioscience	Tempo-iAstro
Human: HIEC-6	ATCC	Cat# CRL-3266; RRID: CVCL_6C21
Human: U-87 MG	ATCC	Cat# HTB-14; RRID: CVCL_0022
Human: Monoclonal NCI-H1975 TMEM106B^KO	This paper	N/A
Human: Monoclonal NCI-H1975 ACE2^KO	This paper	N/A
Human: Monoclonal NCI-H1975 ACE2^KOEXT1^KO	This paper	N/A
Human: Monoclonal NCI-H1975 TMEM106B^KO+ ACE2 cDNA	This paper	N/A
Human: Monoclonal NCI-H1975 TMEM106B^KO+ ACE2 cDNA + EXT1^KO	This paper	N/A
Hamster: BHK-21J	Peter Bredenbeek, LUMC, The Netherlands	N/A
Human: I1-Hybridoma	ATCC	Cat# CRL-2700; RRID: CVCL_G654
Human: HEK293	ATCC	Cat# CRL-1573; RRID: CVCL_0045
Human: A549	ATCC	Cat# CCL-185; RRID: CVCL_0023
Human: A549 expressing TMEM106B cDNA	This paper	N/A
Human: Expi293F	Gibco	CAT# A14527

Experimental models: Organisms/strains

Mouse: NZBWF1/J (female)	Jackson Laboratory	RRID: IMSR_JAX:100008
Mouse: SJL/J (female)	Jackson Laboratory	RRID: IMSR_JAX:000686
Mouse: C57BL/6N TMEM106B knockout (female)	Taconic, Rensselaer, NY	N/A

Oligonucleotides

qPCR primer 229E-FP: TCCGACGTGCTCGAACTTT	Vijgen et al.⁷¹	N/A
qPCR primer 229E-RP: CCAACACGGTTGTGACAGTGA	Vijgen et al.⁷¹	N/A
qPCR probe 229E-TP: FAM-TCCTGAGGT CAATGCA-NFQ-MGB	Vijgen et al.⁷¹	N/A
Oligonucleotides, synthetic genes and gBlocks: see Table S2	This paper	N/A

Recombinant DNA

pMD2.G	Didier Trono	Addgene plasmid # 12259; RRID: Addgene_12259
psPAX2	Didier Trono	Addgene plasmid # 12260; RRID: Addgene_12260
pLentiCRISPRv2	Sanjana et al.⁷²	Addgene plasmid # 52961; RRID: Addgene_52961
pLentiCRISPRv2-Hygro	This paper	N/A
pLCKO	Hart et al.⁶⁹	Addgene plasmid # 73311; RRID: Addgene_73311
pLCKO-CMV-Luc-P2A-Blasti	This paper	N/A
pcDNA3.1-hACE2	Li et al.⁷³	Addgene plasmid #1786; RRID: Addgene_1786
pLCKO-CMV-ACE2-P2A-Blasti	This paper	N/A
pLCKO-CMV-TMEM106B-P2A-Blasti	This paper	N/A
pLCKO-CMV-TMPRSS2-IRES-Hygro	This paper	N/A
pGACGG-nCOV19del18-FLAG	Berend Jan Bosch	N/A
pLCKO-CMV-SARS-CoV-2-S-Bel-P5_5-7-IRES-mNeonGreen-NES/PKI-P2A-Blasti	This paper	N/A
pCAGGS	Niwa et al.⁷⁴	BCCM Cat# LMBP 2453
Plasmid: pCAGGS (KeraFAST EH1017) human TMEM106B (Uniprot Q9NUM4)	Rosenthal et al.⁷⁵	N/A
Plasmid: pCAGGS (KeraFAST EH1017) cyno TMEM106B (Uniprot A0A2K5W4F7)	Rosenthal et al.⁷⁵	N/A
Plasmid: pCAGGS (KeraFAST EH1017) mouse TMEM106B (Uniprot Q80X71)	Rosenthal et al.⁷⁵	N/A
Plasmid: pCDNA3.1 human IgG1 and IgK	Rosenthal et al.⁷⁵	N/A
Expression construct for Wuhan-Hu-1 S1 (residues 1-530)	Rosa et al.⁷⁶	N/A
Expression construct for Belgium/GHB-03021 S1	This work	N/A
Expression construct for ACE2 ectodomain (residues 1-615)	Wrobel et al.⁷⁷	N/A
Expression construct for TMEM106B ectodomain.	This work	N/A
Expression construct for Belgium/GHB-03021 spike ectodomain stabilized with hexa-pro mutations	This work	N/A

Software and algorithms
Geneious Software (v9.1.8)	Geneious	http://www.geneious.com/; RRID: SCR_010519
HCS Studio Cell Analysis software (v 6.6.0)	Thermo Fisher Scientific	RRID: SCR_016787
Cell Profiler (v4.2.4)	Stirling et al.⁷⁸	https://cellprofiler.org/
DIALS	Winter et al.⁷⁹	https://dials.github.io/
Xia2	Winter et al.⁸⁰	https://xia2.github.io/index.html
Phenix	Liebschner et al.⁸¹	http://www.phenix-online.org/
Phaser	McCoy et al.⁸²	https://www.phaser.cimr.cam.ac.uk/index.php/Phaser_Crystallographic_Software
MolProbity	Chen et al.⁸³	http://molprobity.manchester.ac.uk/
AlphaFold	Jumper et al.⁸⁴	https://alphafold.ebi.ac.uk/
Coot	Emsley et al.⁸⁵	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
MotionCor-2	Zheng et al.⁸⁶	https://emcore.ucsf.edu/ucsf-software
Gctf (v1.06)	Zhang et al.⁸⁷	https://www2.mrc-lmb.cam.ac.uk/download/gctf_v1-06-and-examples/
SPHIRE-crYOLO	Wagner et al.⁸⁸	https://cryolo.readthedocs.io/en/stable/
cryoSPARC (v3)	Punjani et al.⁸⁹	https://cryosparc.com/
cryoSPARC (v4)	Punjani et al.⁸⁹	https://cryosparc.com/
Topaz	Bepler et al.⁹⁰	https://guide.cryosparc.com/processing-data/all-job-types-in-cryosparc/deep-picking/topaz
MicrographCleaner	Sanchez-Garcia et al.⁹¹	https://github.com/rsanchezgarc/micrograph_cleaner_em
Relion (v4.0)	Scheres et al.⁹²^,⁹³; Kimanius et al.²⁵	https://relion.readthedocs.io/en/release-4.0/
UCSF Chimera	Pettersen et al.⁹⁴	https://www.cgl.ucsf.edu/chimera/
ProteinLynx Global SERVER (PLGS) (v3.0)	Waters	https://www.waters.com/waters/en_US/ProteinLynx-Global-SERVER-(PLGS)/nav.htm?cid=513821&locale=en_US
DynamX (v3.0)	Waters	https://www.waters.com/waters/library.htm?locale=en_US&lid=134832928
Compass for Simple Western (v6.1.0)	Protein Simple	https://www.bio-techne.com/resources/instrument-software-download-center/compass-software-simple-western; RRID: SCR_022930

Other

400-mesh copper R1.2/1.3 holey carbon grids (Quantifoil)	EMS	Cat# Q4100CR1.3
ACQUITY UPLC BEH C18 VanGuard Pre-column	Waters	Cat# 86003975
ACQUITY UPLC BEH C18 Analytical Column	Waters	Cat# 186002352
Dual Protease column (Pepsin: Type XIII 1:1)	Novabioassays	Cat# NBA2014002