Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Species-specific primers
|
| ||
|---|---|---|
| Organisms | Primer sequence (5´-3´) | Author (References) |
|
| ||
| Porphyromonas. gingivalis | F: AGGCAGCTTGCCATACTG CG R: ACTGTTAGCAACTACCGATGT | Kugaji et al. (17) |
| Fusobacterium nucleatum | F: GAAGAAACAAATGACGGT AACAAC R: GTCATCCCCACCTTCCTCCT | Yamaura et al .2005 (18) |
|
| ||
