Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers and PCR cycling conditions used in this study for amplification of PCV3 ORF1 fragment.
| Primer pair | Nucleotide Sequence (5’– 3’) | Product length (bp) | PCR cycling condition (temperature/time) | |||||
|---|---|---|---|---|---|---|---|---|
|
| ||||||||
| Initial denaturation | Number of cycle | Denaturation | Annealing | Extension | Final extension | |||
| PCV3-69F | CGAGTGGGAATCTATTGTGGA | 69 | 95°C/3 min | 40 | 98°C/20 s | 50°C/30 s | 72°C/50 s | 72°C/10 min |
| PCV3-69R | CCAACCTCTTTGCCGATAAT | |||||||
PCR=Polymerase chain reaction, PCV3=Porcine circovirus 3, ORF1=Open reading frame 1
