Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2023 Jul 24;51(15):8283–8292. doi: 10.1093/nar/gkad599

YLC-assembly: large DNA assembly via yeast life cycle

Bo He 1,2, Yuan Ma 3,4, Fangfang Tian 5,6, Guang-Rong Zhao 7,8, Yi Wu 9,10,✉, Ying-Jin Yuan 11,12,✉
PMCID: PMC10450165  PMID: 37486765

Abstract

As an enabling technique of synthetic biology, the scale of DNA assembly largely determines the scale of genetic manipulation. However, large DNA assembly technologies are generally cumbersome and inefficient. Here, we developed a YLC (yeast life cycle)-assembly method that enables in vivo iterative assembly of large DNA by nesting cell-cell transfer of assembled DNA in the cycle of yeast mating and sporulation. Using this method, we successfully assembled a hundred-kilobase (kb)-sized endogenous yeast DNA and a megabase (Mb)-sized exogenous DNA. For each round, over 104 positive colonies per 107 cells could be obtained, with an accuracy ranging from 67% to 100%. Compared with other Mb-sized DNA assembly methods, this method exhibits a higher success rate with an easy-to-operate workflow that avoid in vitro operations of large DNA. YLC-assembly lowers the technical difficulty of Mb-sized DNA assembly and could be a valuable tool for large-scale genome engineering and synthetic genomics.

Graphical Abstract

Graphical Abstract.

Graphical Abstract

Open in a new tab

INTRODUCTION

DNA assembly is a core technique for genetic modification, especially for large-scale genome engineering. The scale of DNA assembly has developed from genes and metabolic pathways to entire genomes (1,2), which has made great contributions to the understanding and engineering of biological systems (3). Smaller DNA fragments can be assembled by standardized in vitro assembly methods, which are usually based on PCR, restriction endonuclease and exonuclease (4–10). When the length of the DNA is up to 100 kb level, the large DNA fragment could be easily broken by manipulations in vitro (4,11). Large DNA assembly mainly relies on in vivo assembly methods via homologous recombination in the host cells (11). Saccharomyces cerevisiae has become one of the most widely used host for DNA assembly due to its efficient homologous recombination system, convenient molecular manipulation methods and large DNA-carrying capacity (12–14). Wildly used DNA cloning and assembly methods in yeast, such as transformation-associated recombination (TAR) cloning technology (15–24), have made significant contributions to the development of Mb-sized DNA assembly (25–28). However, conventional Mb-sized DNA assembly methods usually require extracting large DNA from the host cells, enriching them in vitro or in Escherichia coli, and then importing them to the host for further assembly (28–30). The inefficiency of import and export of large DNA to host cells severely limit the efficiency of assembly (11).

Here, we developed a yeast life cycle mediated iterative assembly method (termed YLC-assembly). The iterative assembly can be nested with yeast life cycle (31) by the following steps: the process of mating enables two DNA fragments from two haploids to be brought into one diploid to assemble, and the diploid harboring assembled DNA can undergo meiosis to produce spores which could be used for a next round of assembly (Figure 1). Utilizing the specific cleavage capability of the CRISPR/Cas9 system (32), we constructed an orthogonal-cut CRISPR/Cas9 system to facilitate the assembly by linearizing DNA fragments in vivo and enabling the alternate use of designed iterative assembly parts. To verify the multi-round assembly capability of YLC-assembly, we assembled a 95 kb fragment encoding 30 clustered yeast essential genes through YLC-assembly in a step wise manner. To further demonstrate the ability to assemble Mb-sized DNA by YLC assembly in a convergent manner, we assembled a 1.26 Mb of human IGH locus DNA that encodes the variable (IGHV), diversity (IGHD), and joining (IGHJ) genes responsible for antibody heavy-chain biosynthesis, which is crucial for the adaptive immune response and important for constructing immunity humanized animal models (33). Our assembly method circumvents the inefficient in vitro steps and can achieve efficient multiple rounds of assembly entirely in vivo through the yeast life cycle. Each round of YLC-assembly can obtain a large number of positive colonies (>104 per 107 cells) and the assembly accuracy is 67–100%. Compared with other large DNA assembly methods, YLC-assembly provides an easy-to-operate workflow for efficient assembly of Mb-sized DNA.

Figure 1.

Figure 1.

Open in a new tab

Schematic diagram of YLC-assembly. (A) Schematic diagram of iterative assembly nested with the life cycle of budding yeast. Two DNA fragments (colorful rectangles) from two haploids (blue and yellow) with opposite mating types could be brought into one cell (green) to assemble through the process of mating, and the diploid with assembled DNA could undergo meiosis to produce spores which could be used for the next round of assembly. The assembly is facilitated by designed orthogonal-cut CRISPR/Cas9 system, the donor and recipient could be linearized by orthogonal-cut gRNA-Cas9 complexes (represented by scissors) and assembled into a new DNA construct (harboring assembled DNA fragment flanked with a new complete set of assembly iterative parts) by homologous recombination. (B) Schematic diagram of experimental workflow of YLC-assembly.

MATERIALS AND METHODS

Strains and growth medium

The yeast strains used for DNA assembly in this study were derived from BY4741 (MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) and BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0). The Cas9 cassette was obtained from the BYM027 plasmid stored in our laboratory. The Cas9 gene expression cassette (constitutive promoter) were integrated into the can site of the BY4741 and BY4742 genomes by S. cerevisiae lithium acetate transformation (34) to generate BY4741-Cas9 and BY4742-Cas9. It is worth noting that, to allow for the removal of Cas9 protein after the iterative assembly process, the Cas9 gene could also be constructed on an episomal plasmid. In order to design an iterative assembly system for alternate use, the TRP1 gene was deleted from BY4741-Cas9 and BY4742-Cas9. The yeast strains named yHB191 (MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 trp1Δ0 can::Cas9 expression cassette) and yHB192 (MAT α his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trp1Δ0 can::Cas9 expression cassette) were constructed for DNA assembly in this study.

Yeast strains were grown at 30°C in yeast extract–Bacto peptone–dextrose (YPD) medium containing 1% yeast extract, 2% peptone and 2% glucose. For selective growth, the plasmid-harboring strains were cultured in yeast Synthetic Complete (SC) medium. The 2 g/l drop-out mixture for making SC medium contained all possible supplements except four nutritionally deficient amino acids (leucine, histidine, tryptophane and uracil) which need to be added according to different selective types. Liquid yeast culture was grown at 30°C and 220 rpm in incubator. The 2xYPD medium containing 2% yeast extract, 4% peptone and 4% glucose was used for pre-sporulation. Sporulation medium containing 10 g/l potassium acetate, 0.05 g/l zinc acetate dihydrate, 0.1% yeast extract, 0.05% glucose.

Construction of iterative assembly parts

Iterative assembly parts were constructed in this work to facilitate the YLC-assembly (Figure 1A). Four different gRNA (guide RNA)-Cas9 complex target sites (23bp, containing protospacer–PAM (protospacer adjacent motif) sequences) are designed to achieve iterative assembly. The gRNA expression cassettes (termed gRNA1, gRNA2, gRNA3 and gRNA4) corresponding to the four target DNA sites (g1 site: cggtggacttcggctacgtaggg, g2 site: gctgttcgtgtgcgcgtcctggg, g3 site: cgccgctccgagggccgcacggg and g4 site: gttgcaaatgctccgtcgacggg) (35) were obtained by PCR and overlap-PCR. The selection maker genes URA3, TRP1, HIS3 (on the plasmid backbone) and LEU2 (on the plasmid backbone) were amplified from plasmids pRS416, pRS414, pRS413 and pRS415, respectively. Using the PCC1 plasmid as a template, the homology arm fragments (∼400 bp) between the DNA fragments and the plasmid were amplified (vector homologous arm).

Construction of starting strains for assembly of clustered yeast essential genes

Using Phanta Max Super-Fidelity DNA polymerase (Vazyme) high-fidelity enzyme, the S. cerevisiae essential genes were amplified individually by PCR from the genome of BY4741. 60–70 bp homologous arms were introduced to the ends of designed neighboring genes by primers through the process of PCR. In the same way, homologous arms were added to assembly iterative parts and the vector. KOD-one PCR Master Mix (TOYOBO) DNA polymerase was used to amplify the vectors from template PCC1 plasmid. All the PCR products were purified by TIANgel Midi Purification Kit (TIANGEN). Essential genes designed in one starting strain, the assembly iterative parts and the vector backbone were co-transformed into S. cerevisiae by lithium acetate transformation (34). The essential genes, the assembly iterative parts and the vector were assembled into a plasmid using TAR cloning method (29,36).

Construction of starting strains for assembly of Mb-sized IGH DNA

Six BACs (CH17-185P21, CH17-224D4, CH17-60O17, CH17-268I9, CH17-314I7, RP11-671P4 from BACPAC Resources Center (BPRC), accession: AC246787, AC247036, AC245166, AC244452, AC245023, AL590875) were used for the Mb-sized YLC-assembly in this study. Plasmid extraction kit (Plasmid Midi Kit, QIAGEN) was used to extract the six BACs in Escherichia coli from the BAC library, and the appropriate restriction sites (BAC CH17-60O17 was digested by BsiWI (NEB) and the rest of the BACs were digested by Not I (NEB)) were selected at both ends of the DNA fragment to digest the BACs and linearize the DNA fragments to be assembled. In order to more efficiently construct YACs with the large YACs with 200 kb-level IGH fragments, functional vectors loaded with assembly iterative parts and homologous arms (500∼1000 bp homologous arms between fragments were designed to add to ends of DNA fragments (F2&F3, F3&F4 are not added because they already have homologous arms)) were pre-constructed. DNA in vitro assembly enzyme (NEBulider hifi DNA assembly master mix, NEB) was used to assemble the vectors and the iterative parts into pre-constructed functional vectors. Then DNA polymerase (KOD-one PCR Master Mix, TOYOBO) was used to amplify the pre-constructed vectors. The linear 200 kb-level DNA fragment (2–5 μg) and the pre-constructed functional vector (1 μg) were co-transferred into yHB191 or yHB192 by yeast spheroplast transformation (23). By this way, starting strains harboring 200 kb-level YACs for Mb-sized iterative assembly could be constructed using TAR cloning (29,36).

DNA assembly via yeast mating

Haploids with opposite mating types can mate to form diploids under nutrient-adequate conditions. Single colonies were inoculated into 5 ml SC medium and grown at 30°C, 250 rpm overnight to reach OD600 4–5. Approximately equal amounts of haploids (about 200 μl was taken) with opposite mating type were co-cultured in 5 ml fresh YPD medium. Mating occurs when two haploids with opposite mating types are co-cultured. DNA fragments spontaneously assembly facilitated by the orthogonal-cut CRISPR/cas9 system in diploid cells. After co-culturing for 8–12 h, the mating medium was diluted by 102 to 103 times and 100 μl was taken for plating (on selective medium). Plates were incubated in a 30°C incubator for 1–2 days. Candidate colonies were picked from selective medium and verified by the PCR validation of new junctions. The colony PCR validation was performed as described before (37). Positive colonies were picked for further full-length PCRTag analysis and PFGE validation.

Sporulation and continuous iterative assembly though yeast life cycle

The diploid colonies were inoculated into 5 ml pre-sporulation medium (2xYPD medium) at 30°C, 250 rpm for 6–8 h. 500 μl–1 ml of the culture medium were collected by centrifugation at 4000 rpm for 2 min and then washed three times by sterile water. Then the diploid cells were cultured in sporulation medium (see Strains and growth medium) at 25°C, 180 rpm for 3–5 days with the initial OD600 = 1. When the tetrad could be observed by microscope, the yeast tetrads were collected by centrifugation at 4000 rpm for 2 min. The tetrads were resuspended with 1M sorbitol solution and digested the yeast tetrad cell walls with zymolyase (2 mg ml−1 zymolyase 20 T, 10 mM sodium phosphate, pH 7.5) in preparation for dissection. A dissection microscope (SporePlay+, SINGER INSTRUMENTS) was used to dissect yeast tetrads. Spores were segregated and lined up on screening SC plates. Then colony PCR analysis was performed on haploid colonies. The positive haploid colonies could be used for the next round of assembly.

Pulsed-field gel electrophoresis (PFGE) validation

The size of the small circular plasmid (20–200 kb) could be purified and validated by PFGE analysis after restriction enzyme (AscI, NEB) digesting. Maker Mid-Range was used to indicate the size of the assembled DNA sequences. The conditions of PFGE program were set as the protocol of the maker (MidRange PFG maker, NEB): the voltage was 6 V/cm, at an angle of 120°, switch time from initial 1 s to final 25 s, and 10°C for 16 h.

Since it is difficult to extract intact highly purified large DNA (>250 kb) from yeast for analysis, the sizes of large DNA were validated by a topological trapping (28) strategy with little modifications. For the assembly of Mb-sized IGH sequence, in which the size of assembled DNA constructs ranges from 400 to Mb level, yeast spheroplasts harboring large circular DNA constructs were embedded in low-melting agarose plugs using a previously published protocol (38) and the size of the assembly constructs were validated through two-time PFGE. Plugs were inserted into a 1.0% agarose gel in 0.5× TBE on a BioRad CHEF Mapper apparatus. For the first PFGE, all the linear yeast chromosomes were separated out of the agarose plugs while the large assembled circular DNA construct was still trapped in the agarose plugs. For the second time, the agarose plugs were removed from the agarose gel and digested for 2–3 h by restriction enzyme (AsiSI, NEB) before the second PFGE analysis. The conditions of PFGE program were both set as: the voltage was 6 V/cm, at an angle of 120°, switch time from initial 60s to final 120s, and 10°C for 22 h. Using a wild-type BY4741 genome agarose plug as maker, the sizes of the assembled large DNA constructs (200 kb–1.5 Mb) could be validated.

Whole-genome sequencing and analysis

Whole-genome sequencing was performed on yeast strains harboring the assembled IGH sequence. Preparation of yeast genomic DNA along with the assembled DNA for DNA sequencing was performed as described in a previous study (39). The constructed libraries were subjected to Illumina NovaSeq sequencing (paired-end) (by Genewiz). The software Bcl2fastq (v2.17.1.14) was used to perform image base calling on the original image data from the sequencing results to obtain the pass filter data. Then the software fastp (v0.23.0) was used to remove adapters and low-quality sequences from the pass filter data to obtain clean data for subsequent information analysis. The software sentieon (v202112.02) bwa was employed to align the clean data to the reference genome sequence, generating a sequence alignment file in SAM (Sequence Alignment/Map) format. The depth of each base was counted by samtools from the BAM (binary SAM file) file, which was subsequently visualized as sequencing depth maps.

RESULTS

The rationale of iterative DNA assembly via budding yeast life cycle

The overall efficiency of large DNA assembly in vivo depends on the efficiency of importing and exporting intact DNA fragments to host cells and the efficiency of intracellular homologous recombination (40). To improve the efficiency of importing and exporting intact DNA fragments, we developed a strategy to nest cell-cell transfer of assembled DNA with the budding yeast life cycle. As shown in Figure 1A, the DNA fragments to be assembled were respectively constructed in two haploids with opposite mating types in the form of circular plasmids. Both haploids had already expressed sufficient gRNA-Cas9 complex (Cas9 gene was integrated in the genome with a constitutive promoter) that target designed sites in the haploids with opposite mating types before yeast mating, enabling timely and efficient double strands breaks in the homologous regions once mated. Take the first round of assembly in Figure 1A as an example. Firstly, a mating-mediated fusion of two haploid cells with opposite mating types allows DNA fragments and the iterative assembly parts (including orthogonal-cut CRISPR/Cas9 system and selective makers) to import into one cell. Secondly, once the two plasmids are in the same cell, the gRNA1 transcript from the recipient plasmid guides Cas9 to cut the designed g1 sites to linearize the DNA fragment on the donor plasmid, while the gRNA2 transcript from the donor plasmid guides Cas9 to cut the designed g2 sites to linearize the DNA fragment on the recipient plasmid. Then the linearized DNA fragment from the donor plasmid is assembled into the linearized recipient plasmid through yeast homologous recombination, meanwhile, the iterative parts in the recipient plasmid is replaced by the iterative parts from the donor plasmid (Figure 1A). Screening of the correctly assembled diploids would be performed by double selections of the replaced iterative parts and the reassembled vectors. Then the positive diploids could undergo meiosis to produce haploid spores (41) and the assembled DNA construct could be transferred into the spores along with meiosis. As the assembly details show on the right of Figure 1A, every newly assembled DNA fragment was still flanked with a complete set of assembly iterative parts, which was designed to facilitate the next round of iterative assembly. Our assembly method nested the iterative assembly with the process of mating and sporulation in the yeast life cycle (Figure 1B), enabling a completely in vivo assembly process with an easy-to-use workflow.

Stepwise assembly of clustered yeast essential genes by YLC-assembly

To demonstrate the assembly capability of YLC-assembly, we assembled a 95 kb DNA fragment containing 30 essential genes from S. cerevisiae through three rounds of stepwise YLC-assembly (Figure 2A). The 30 genes were assigned to four starting strains and they were constructed by one step yeast assembly (36). Then the haploid strains yTFF100 and yTFF101 (with different mating types) were inoculated overnight and co-cultured for 8–12 h. Mating mediated cell fusion of yTFF100 & yTFF101 and subsequent assembly of the DNA fragments occurs during the process of co-culture. The diploid strain yTFF102 (produced by mating between yTFF100 & yTFF101) was then diluted and plated on the selective medium. After incubated for 1∼2 days, we found that more than 105 colonies could be obtained per 107 cells from the mating medium (Figure 2B, C). A total of 24 individual diploid colonies were randomly picked and PCR validations for the assembled junctions were performed. The average assembly accuracy for yTFF102 is 94.4%. Then the correctly assembled yTFF102 diploid was sporulated, during which the diploid yeast underwent meiosis and the assembled DNA constructs were transferred to spores. The diploid cells were cultured in a sporulation medium for 3∼5 days until tetrads could be observed by microscope. Then the haploid yeast strain was generated by dissection of the tetrads using a SporePlay microscope (SINGER INSTRUMENTS) (Figure 2D). Intactness of the assembled sequence in candidate yeast was further validated by full-length PCRTag analysis (Figure S1, S2, primers were listed in Table S1). The haploid strain with opposite mating type of yTFF103 was selected for the second round of YLC-assembly. The second and third rounds of stepwise YLC-assembly were conducted similarly to the first round. The average assembly accuracy of the second and third round is 100% and 84.7% (Figure 2E), respectively. To further demonstrate the intactness of the assembled DNA constructs, Pulsed-Field Gel Electrophoresis (PFGE) validations were performed. The correct sizes of the assembled DNA fragments were shown in Figure 2F, indicating that the clustered yeast essential genes (95 kb in length) were successfully assembled by stepwise YLC-assembly. The diploid yTFF106 harboring 95 kb clustered yeast essential genes still has the capability to undergo meiosis and continue the next round of YLC-assembly. These experimental results demonstrated that YLC-assembly can perform multiple rounds of efficient iterative assembly, and each round of assembly can obtain a large number of positive colonies without any cumbersome operations in vitro.

Figure 2.

Figure 2.

Open in a new tab

Stepwise assembly of clustered yeast essential genes by YLC-assembly. (A) Stepwise assembly workflow chart of clustered yeast essential genes. The assembled sizes of DNA constructs (the plasmid backbone is not included) in three rounds of stepwise YLC-assembly are 23, 48 and 95 kb, respectively. (B) A large number of positive colonies could be obtained in the three rounds of stepwise YLC-assembly. Mating cells were plated on the selective medium for screening. (C) The number of colonies obtained on screening plate per 107 cells from the mating medium. A total of 24 strains were tested for each replicate and the error bars indicate the standard deviations of all (n = 3) biological replicates. (D) Tetrads from the assembled diploid were dissected and the spores were lined up on the selective medium. (E) Assembly accuracy of the clustered yeast essential genes. The assembly accuracy was characterized by the PCR positive ratio of correctly assembled junctions. A total of 24 strains were tested for each replicate and the error bars indicate the standard deviations of all (n = 3) biological replicates. (F) PFGE validations of the assembled strains. The assembled circular DNA constructs were extracted from yeast and digested by AscI for PFGE analysis. Digestion of AscI released the assembled DNA fragment from the vector (two vector backbones carrying different screening genes were used in the iterative assembly process, and the length of the two vector backbones differs by 1–2 kb), and the correct assembled sizes were shown in the figure. A MidRange PFG maker (NEB) was used.

Convergent assembly of Mb-sized IGH DNA by YLC-assembly

To demonstrate the Mb-sized assembly capability for YLC-assembly, six BACs (CH17-185P21, CH17-224D4, CH17-60O17, CH17-268I9, CH17-314I7, RP11-671P4 from BACPAC Resources Center (BPRC)) were assembled. The assembled fragment encodes ∼1 Mb-sized human IGH genes (Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes) and a marker gene HPRT. These large DNA fragments F1–F6 were first linearized by restriction endonucleases and then assembled with respective vectors which had loaded with the iterative assembly parts (including orthogonal-cut CRISPR/Cas9 system and selective makers) by yeast spheroplast transformation (23) (see Materials and Methods). The iterative assembly was designed convergently, which can minimize the number of assembly rounds. For this Mb-sized assembly, three rounds of YLC-assembly were designed (Figure 3A). For each assembly unit, experimental operations of Mb-level YLC-assembly were similarly to that of small DNA YLC-assembly described before (Figure 1B). For Mb-sized YLC-assembly, we found that ∼105 colonies could be easily obtained on the screen medium per 107 cells from the mating medium (Figure 3B, Supplementary Figure S3). To determine the accuracy of assembled DNA construct by YLC-assembly, 24 colonies were randomly selected and PCR validations of assembly junctions were performed for each assembly reaction. The assembly accuracy of three ∼400 kb fragments in the first round of assembly was 91.6%, 81.2% and 93.7%, respectively (Figure 3C). And the assembly accuracy of the second and third round is 80.5% and 84.7%, respectively (Figure 3C). We further validate the size of the assembled DNA constructs by PFGE analysis. The assembled circular DNA constructs were isolated from yeast in low-melting agarose plugs and PFGE analysis was performed after restriction enzyme digesting. The bands observed in the PFGE gel were correspond to the correct sizes, demonstrating that the DNA constructs were assembled correctly and providing evidence that Mb-sized DNA could be assembled by YLC assembly (Figure 3D). In addition, the final yeast strain yHB211 was positive for the 56 pairs of PCRTags distributed among the F1-F6 fragments (Figure 3E, primers were listed in Table S2). To further demonstrate the integrity of the assembled 1.26 Mb IGH DNA sequence in yeast, we performed whole-genome sequencing (WGS) on the diploid strains yHB211 and the haploid strains from meiosis of yHB211. The sequencing depth map indicates that no segmental deletion was detected in the assembled Mb-sized IGH DNA compared to the reference sequence (Figure 3F, G). In addition, no obvious structure variations were observed in the native yeast chromosomes (Figure 3F). In order to assess the stability of the assembled IGH during yeast propagation, we performed a 15-day consecutive subculturing of the candidate strain yHB211. The stability of the assembled IGH constructs was confirmed through PCRTag and WGS analysis (Supplementary Figures S5 and S6). For these YLC-assembly of up to Mb-sized DNA, the number of colonies and the assembly accuracy were relatively stable, indicating that the YLC-assembly could be a size-independent assembly method.

Figure 3.

Figure 3.

Open in a new tab

Convergent assembly of Mb-sized IGH DNA by YLC-assembly. (A) Convergent assembly workflow chart of Mb-sized human IGH. Six DNA fragments from the six BACs were named F1 (205 kb), F2 (220 kb), F3 (190 kb), F4 (238 kb), F5 (212 kb) and F6 (195 kb), respectively. The sizes (the plasmid backbone is not included) of DNA constructs assembled in the first round of convergent YLC-assembly were 424, 426 and 407 kb, respectively. 833 kb and 1.26 Mb DNA were assembled in the second and third rounds of assembly, respectively. (B) The number of colonies obtained on screening plate per 107 cells from the mating medium. A total of 24 strains were tested for each replicate and the error bars indicate the standard deviations of all (n = 3) biological replicates. (C) Assembly accuracy of the Mb-sized IGH genes. The assembly accuracy was characterized by the PCR positive ratio of correctly assembled junctions. A total of 24 strains were tested for each replicate and the error bars indicate the standard deviations of all (n = 3) biological replicates. (D) PFGE validations of the assembled strains. Assembled circular DNA construct was isolated from yeast in low-melting agarose plugs and subjected to PFGE analysis after enzyme restriction by AsiSI. Using wild-type S. cerevisiae chromosomes as maker, the correct sizes of the assembled DNA constructs (total length of the assembled DNA fragment and the vector) were indicated beside the bands. (E) PCR analysis of the final yeast strain yHB211. A total of 56 pairs of primers were designed in the 1.26 Mb DNA sequence of F1-F6 fragments (Table S2). (F) Whole-genome sequencing depth map of S. cerevisiae strain harboring assembled Mb-sized IGH sequences (yHB211). I∼XVI represent the 16 chromosomes of S. cerevisiae. The sequencing depth is displayed per 1000 bp of the reference sequences. (G) The whole-genome sequencing depth map of S. cerevisiae haploid strain dissected from diploid strains (haploid strains lined up on screening plate, see figure S4). The sequencing depth is displayed per 1000 bp of the reference sequences.

DISCUSSION

YLC-assembly nested large DNA iterative assembly with the yeast life cycle, which could greatly improve the efficiency of importing and exporting intact large DNA fragments during assembly. During the iterative assembly of YLC-assembly, inefficient and cumbersome operations such as preparation of highly purified intact large DNA (28) and yeast spheroplasts fusion (25,48) are not required. Compared to TAR cloning that requires transformation of the vector from in vitro into yeast (49), YLC-assembly does not involve the transformation of large DNA fragments from in vitro to yeast or the extraction of DNA molecules from cells throughout the entire iterative assembly process. In the Sc2.0 project, two DNA assembly methods SwAP-In (switching auxotrophies progressively for integration) and MRA (meiotic recombination mediated assembly) were developed to assemble Mb-sized synthetic yeast chromosomes (43–47). The process of YLC-assembly should be more efficient than the stepwise SwAP-In method and the MRA method which utilize the relatively inefficient meiotic recombination. Compared with the previous Mb-sized DNA assembly methods in S. cerevisiae (Table 1), YLC-assembly shows a higher success rate with an easy-to-operate workflow. To further simplify the operations of YLC-assembly, dissection of tetrads by manual micromanipulation could be replaced by random spore analysis (50). However, each round of YLC-assembly may require a long experimental period (approximately 11 days) due to the process of sporulation, which should be optimized in the future.

Table 1.

Comparison of large DNA assembly methods in S. cerevisiae

Assembly method Assembly mechanism Assembly accuracy* CFU Size of assembled largest DNA constructs Ref.
Yeast spheroplast transformation mediated TAR (Transformation-associated recombination) Homologous recombination between DNA fragments and vector 0.2–25% <102 1.08 Mb (15–19,28)
SwAP-In (Switching auxotrophies progressively for integration) Homologous recombination between DNA fragments and chromosome 0.5–59% <103 0.24–0.77 Mb (42–46)
MRA (Meiotic recombination–mediated assembly) Crossover recombination during meiosis NA NA 0.98 Mb (47)
CasHRA (Cas9-facilitated homologous recombination assembly) CRISPR/Cas9 facilitated assembly of DNA fragments through yeast protoplast fusion 63–75% <102 1.03 Mb (25)
YLC-assembly (Assembly via Yeast Life Cycle) Iterative assembly via yeast life cycle facilitated by orthogonal-cut CRISPR/Cas9 67–100% >104 1.26 Mb This study
Open in a new tab

*The assembly accuracy was calculated for assembled DNA constructs larger than 100-kb in size.

In the assembly of Mb-sized IGH DNA sequences, segmental deletions were observed through WGS analysis of candidate strains and further analysis of the deleted DNA fragments (Supplementary Figure S7) revealed that the instability may be mediated by interspersed repeats across the IGH locus (33). It is worth noting that the instability of complex repetitive DNA poses a common challenge for all in vivo assembly methods based on homologous recombination. To avoid instability arising from repeated sequences, one approach is to develop site-specific recombination techniques for assembling DNA in host organisms with limited homologous recombination ability, such as mammalian cells (51–53). In addition, methods to regulate the level of homologous recombination could be developed in yeast to maintain the stability of large DNA with complex repetitive structures in the future.

In this work, a Mb-sized human IGH fragment was assembled by three rounds of YLC-assembly, among which the number of candidate colonies and the assembly accuracy was relatively stable for each assembly, indicating that the YLC-assembly could be a size-independent assembly method. Through our YLC-assembly method, Mb-sized DNA fragments could be easily assembled and then engineered by the efficient yeast genetic editing tools (54). It was reported that a single chromosome up to ten Mb-sized either in linear form or circular form could be viable in S. cerevisiae (55,56). This strengthens the feasibility of using YLC-assembly for even larger DNA assembly, which presents an attractive avenue for the design and construction of synthetic mammalian chromosomes (57,58). Moreover, with the development of large DNA delivery technologies, large DNA assembled in S. cerevisiae can also be delivered to other cells by various delivery technologies such as mating-based chromosome delivery (59,60), and spheroplasts fusion (61–63), which has a promising prospect for large DNA manipulation for more species.

Supplementary Material

gkad599_Supplemental_File
Click here for additional data file. (5.7MB, docx)

Contributor Information

Bo He, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Yuan Ma, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Fangfang Tian, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Guang-Rong Zhao, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Yi Wu, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Ying-Jin Yuan, Frontiers Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China; Frontiers Research Institute for Synthetic Biology, Tianjin University, Tianjin 300072, China.

Data Availability

All processed data are included in the manuscript or provided as supplementary data. All the whole genome sequencing data in this paper have been deposited in the NCBI database (https://www.ncbi.nlm.nih.gov/) under the BioProject ID: PRJNA984446.

SUPPLEMENTARY DATA

Supplementary Data are available at NAR Online.

FUNDING

National Key R&D Program of China, Synthetic Biology Research [2019YFA0903800]; National Natural Science Foundation of China [31971351]. Funding for open access charge: National Key R&D Program of China, Synthetic Biology Research [2019YFA0903800]; National Natural Science Foundation of China [31971351].

Conflict of interest statement. None declared.

REFERENCES

  • 1. Casini A., Storch M., Baldwin G.S., Ellis T.. Bricks and blueprints: methods and standards for DNA assembly. Nat. Rev. Mol. Cell Bio. 2015; 16:568–576. [DOI] [PubMed] [Google Scholar]
  • 2. Ellis T., Adie T., Baldwin G.S.. DNA assembly for synthetic biology: from parts to pathways and beyond. Integr. Biol.-UK. 2011; 3:109–118. [DOI] [PubMed] [Google Scholar]
  • 3. Coradini A.L.V., Hull C.B., Ehrenreich I.M.. Building genomes to understand biology. Nat. Commun. 2020; 11:6177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Gibson D.G., Young L., Chuang R.Y., Venter J.C., Hutchison C.A., Smith H.O.. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 2009; 6:343–345. [DOI] [PubMed] [Google Scholar]
  • 5. Zhang Y.W., Werling U., Edelmann W.. SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Res. 2012; 40:e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Li M.Z., Elledge S.J.. Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat. Methods. 2007; 4:251–256. [DOI] [PubMed] [Google Scholar]
  • 7. Xia Y., Li K., Li J., Wang T., Gu L., Xun L.. T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis. Nucleic Acids Res. 2019; 47:e15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Anderson J.C., Dueber J.E., Leguia M., Wu G.C., Goler J.A., Arkin A.P., Keasling J.D.. BglBricks: a flexible standard for biological part assembly. J Biol. Eng. 2010; 4:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Shetty R.P., Endy D., Knight T.F. Jr.. Engineering BioBrick vectors from BioBrick parts. J Biol. Eng. 2008; 2:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Stemmer W.P., Crameri A., Ha K.D., Brennan T.M., Heyneker H.L.. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. 1995; 164:49–53. [DOI] [PubMed] [Google Scholar]
  • 11. Juhas M., Ajioka J.W.. High molecular weight DNA assembly in vivo for synthetic biology applications. Crit. Rev. Biotechnol. 2017; 37:277–286. [DOI] [PubMed] [Google Scholar]
  • 12. Gibson D.G. Gene and genome construction in yeast. Curr. Protoc. Mol. Biol. 2011; Chapter 3:Unit3.22. [DOI] [PubMed] [Google Scholar]
  • 13. Gibson D.G. Oligonucleotide assembly in yeast to produce synthetic DNA fragments. Methods Mol. Biol. 2012; 852:11–21. [DOI] [PubMed] [Google Scholar]
  • 14. Muller H., Annaluru N., Schwerzmann J.W., Richardson S.M., Dymond J.S., Cooper E.M., Bader J.S., Boeke J.D., Chandrasegaran S.. Assembling large DNA segments in yeast. Methods Mol. Biol. 2012; 852:133–150. [DOI] [PubMed] [Google Scholar]
  • 15. Larionov V., Kouprina N., Graves J., Chen X.N., Korenberg J.R., Resnick M.A.. Specific cloning of human DNA as yeast artificial chromosomes by transformation-associated recombination. Proc. Natl. Acad. Sci. U.S.A. 1996; 93:491–496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Larionov V., Kouprina N., Solomon G., Barrett J.C., Resnick M.A.. Direct isolation of human BRCA2 gene by transformation-associated recombination in yeast. Proc. Natl. Acad. Sci. U.S.A. 1997; 94:7384–7387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Kouprina N., Annab L., Graves J., Afshari C., Barrett J.C., Resnick M.A., Larionov V.. Functional copies of a human gene can be directly isolated by transformation-associated recombination cloning with a small 3′ end target sequence. Proc. Natl. Acad. Sci. U.S.A. 1998; 95:4469–4474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Larionov V., Kouprina N., Nikolaishvili N., Resnick M.A.. Recombination during transformation as a source of chimeric mammalian artificial chromosomes in yeast (YACs). Nucleic Acids Res. 1994; 22:4154–4162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Larionov V., Kouprina N., Graves J., Resnick M.A.. Highly selective isolation of human dnas from rodent-human hybrid cells as circular yeast artificial chromosomes by transformation-associated recombination cloning. Proc. Natl. Acad. Sci. U.S.A. 1996; 93:13925–13930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Larionov V. Direct isolation of specific chromosomal regions and entire genes by TAR cloning. Genet. Eng. (N. Y.). 1999; 21:37–55. [DOI] [PubMed] [Google Scholar]
  • 21. Kouprina N., Noskov V.N., Larionov V.. Selective isolation of large segments from individual microbial genomes and environmental DNA samples using transformation-associated recombination cloning in yeast. Nat. Protoc. 2020; 15:734–749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Kouprina N., Ebersole T., Koriabine M., Pak E., Rogozin I.B., Katoh M., Oshimura M., Ogi K., Peredelchuk M., Solomon G.et al.. Cloning of human centromeres by transformation-associated recombination in yeast and generation of functional human artificial chromosomes. Nucleic Acids Res. 2003; 31:922–934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Kouprina N., Larionov V.. Selective isolation of genomic loci from complex genomes by transformation-associated recombination cloning in the yeast Saccharomyces cerevisiae. Nat. Protoc. 2008; 3:371–377. [DOI] [PubMed] [Google Scholar]
  • 24. Kouprina N., Noskov V.N., Larionov V.. Selective isolation of large chromosomal regions by transformation-associated recombination cloning for structural and functional analysis of mammalian genomes. Methods Mol. Biol. 2006; 349:85–101. [DOI] [PubMed] [Google Scholar]
  • 25. Zhou J.T., Wu R.H., Xue X.L., Qin Z.J.. CasHRA (Cas9-facilitated Homologous Recombination Assembly) method of constructing megabase-sized DNA. Nucleic Acids Res. 2016; 44:e124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Dymond J.S., Richardson S.M., Coombes C.E., Babatz T., Muller H., Annaluru N., Blake W.J., Schwerzmann J.W., Dai J.B., Lindstrom D.L.et al.. Synthetic chromosome arms function in yeast and generate phenotypic diversity by design. Nature. 2011; 477:471–476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Hutchison C.A., Chuang R.Y., Noskov V.N., Assad-Garcia N., Deerinck T.J., Ellisman M.H., Gill J., Kannan K., Karas B.J., Ma L.et al.. Design and synthesis of a minimal bacterial genome. Science. 2016; 351:aad6253. [DOI] [PubMed] [Google Scholar]
  • 28. Gibson D.G., Glass J.I., Lartigue C., Noskov V.N., Chuang R.Y., Algire M.A., Benders G.A., Montague M.G., Ma L., Moodie M.M.et al.. Creation of a bacterial cell controlled by a chemically synthesized genome. Science. 2010; 329:52–56. [DOI] [PubMed] [Google Scholar]
  • 29. Gibson D.G. Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides. Nucleic Acids Res. 2009; 37:6984–6990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Gibson D.G., Benders G.A., Andrews-Pfannkoch C., Denisova E.A., Baden-Tillson H., Zaveri J., Stockwell T.B., Brownley A., Thomas D.W., Algire M.A.et al.. Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. 2008; 319:1215–1220. [DOI] [PubMed] [Google Scholar]
  • 31. Herskowitz I. Life cycle of the budding yeast saccharomyces cerevisiae. Microbiol. Rev. 1988; 52:536–553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Lee N.C.O., Larionov V., Kouprina N.. Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast. Nucleic Acids Res. 2015; 43:e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Watson C.T., Steinberg K.M., Huddleston J., Warren R.L., Malig M., Schein J., Willsey A.J., Joy J.B., Scott J.K., Graves T.A.et al.. Complete haplotype sequence of the Human immunoglobulin heavy-chain variable, diversity, and joining genes and characterization of allelic and copy-number variation. Am. J. Hum. Genet. 2013; 92:530–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Gietz R.D., Woods R.A.. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Method Enzymol. 2002; 350:87–96. [DOI] [PubMed] [Google Scholar]
  • 35. Mitchell L.A., Chuang J., Agmon N., Khunsriraksakul C., Phillips N.A., Cai Y.Z., Truong D.M., Veerakumar A., Wang Y.X., Mayorga M.et al.. Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae. Nucleic Acids Res. 2015; 43:6620–6630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Gibson D.G., Benders G.A., Axelrod K.C., Zaveri J., Algire M.A., Moodie M., Montague M.G., Venter J.C., Smith H.O., Hutchison C.A.. One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome. Proc. Natl. Acad. Sci. U.S.A. 2008; 105:20404–20409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Wang P.X., Xu H., Li H., Chen H.B., Zhou S.J., Tian F.F., Li B.Z., Bo X.C., Wu Y., Yuan Y.J.. SCRaMbLEing of a synthetic yeast chromosome with clustered essential genes reveals synthetic lethal interactions. Acs Synth. Biol. 2020; 9:1181–1189. [DOI] [PubMed] [Google Scholar]
  • 38. Schwartz D.C., Cantor C.R.. Separation of yeast chromosome-sized dnas by pulsed field gradient gel electrophoresis. Cell. 1984; 37:67–75. [DOI] [PubMed] [Google Scholar]
  • 39. Annaluru N., Muller H., Mitchell L.A., Ramalingam S., Stracquadanio G., Richardson S.M., Dymond J.S., Kuang Z., Scheifele L.Z., Cooper E.M.et al.. Total synthesis of a functional designer eukaryotic chromosome. Science. 2014; 344:55–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Wang K.H., Fredens J., Brunner S.F., Kim S.H., Chia T.S., Chin J.W.. Defining synonymous codon compression schemes by genome recoding. Nature. 2016; 539:59–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Neiman A.M. Sporulation in the Budding Yeast saccharomyces cerevisiae. Genetics. 2011; 189:737–765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Richardson S.M., Mitchell L.A., Stracquadanio G., Yang K., Dymond J.S., DiCarlo J.E., Lee D., Huang C.L.V., Chandrasegaran S., Cai Y.Z.et al.. Design of a synthetic yeast genome. Science. 2017; 355:1040–1044. [DOI] [PubMed] [Google Scholar]
  • 43. Mitchell L.A., Wang A., Stracquadanio G., Kuang Z., Wang X., Yang K., Richardson S., Martin J.A., Zhao Y., Walker R.et al.. Synthesis, debugging, and effects of synthetic chromosome consolidation: synVI and beyond. Science. 2017; 355:eaaf4831. [DOI] [PubMed] [Google Scholar]
  • 44. Shen Y., Wang Y., Chen T., Gao F., Gong J., Abramczyk D., Walker R., Zhao H., Chen S., Liu W.et al.. Deep functional analysis of synII, a 770-kilobase synthetic yeast chromosome. Science. 2017; 355:eaaf4791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Xie Z.X., Li B.Z., Mitchell L.A., Wu Y., Qi X., Jin Z., Jia B., Wang X., Zeng B.X., Liu H.M.et al.. Perfect” designer chromosome V and behavior of a ring derivative. Science. 2017; 355:eaaf4704. [DOI] [PubMed] [Google Scholar]
  • 46. Wu Y., Li B.Z., Zhao M., Mitchell L.A., Xie Z.X., Lin Q.H., Wang X., Xiao W.H., Wang Y., Zhou X.et al.. Bug mapping and fitness testing of chemically synthesized chromosome X. Science. 2017; 355:eaaf4706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zhang W., Zhao G., Luo Z., Lin Y., Wang L., Guo Y., Wang A., Jiang S., Jiang Q., Gong J.et al.. Engineering the ribosomal DNA in a megabase synthetic chromosome. Science. 2017; 355:eaaf3981. [DOI] [PubMed] [Google Scholar]
  • 48. Curran B.P., Bugeja V.C.. Protoplast fusion in Saccharomyces cerevisiae. Methods Mol. Biol. 1996; 53:45–49. [DOI] [PubMed] [Google Scholar]
  • 49. Larionov V., Kouprina N., Eldarov M., Perkins E., Porter G., Resnick M.A.. Transformation-associated recombination between diverged and homologous DNA repeats is induced by strand breaks. Yeast. 1994; 10:93–104. [DOI] [PubMed] [Google Scholar]
  • 50. Cold Spring Harbor Laboratory Amberg D.C., Burke D., Strathern J.N., Burke D.. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. 2005; NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
  • 51. Lee N.C.O., Kim J.H., Petrov N.S., Lee H.S., Masumoto H., Earnshaw W.C., Larionov V., Kouprina N.. Method to assemble genomic DNA fragments or genes on Human artificial chromosome with regulated kinetochore using a multi-integrase system. ACS Synth. Biol. 2018; 7:63–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Lee N.C.O., Petrov N.S., Larionov V., Kouprina N.. Assembly of multiple full-size genes or genomic DNA fragments on Human artificial chromosomes using the Iterative integration system. Curr. Protoc. 2021; 1:e316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Lee E.C., Liang Q., Ali H., Bayliss L., Beasley A., Bloomfield-Gerdes T., Bonoli L., Brown R., Campbell J., Carpenter A.et al.. Complete humanization of the mouse immunoglobulin loci enables efficient therapeutic antibody discovery. Nat. Biotechnol. 2014; 32:356–363. [DOI] [PubMed] [Google Scholar]
  • 54. Vashee S., Arfi Y., Lartigue C.. Budding yeast as a factory to engineer partial and complete microbial genomes. Curr. Opin. Syst. Biol. 2020; 24:1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Shao Y., Lu N., Cai C., Zhou F., Wang S., Zhao Z., Zhao G., Zhou J.Q., Xue X., Qin Z.. A single circular chromosome yeast. Cell Res. 2019; 29:87–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Shao Y.Y., Lu N., Wu Z.F., Cai C., Wang S.S., Zhang L.L., Zhou F., Xiao S.J., Liu L., Zeng X.F.et al.. Creating a functional single-chromosome yeast. Nature. 2018; 560:331–335. [DOI] [PubMed] [Google Scholar]
  • 57. Boeke J.D., Church G., Hessel A., Kelley N.K., Arkin A., Cai Y., Carlson R., Chakravarti A., Cornish V.W., Holt L.et al.. The Genome Project-write. Science. 2016; 353:126–127. [DOI] [PubMed] [Google Scholar]
  • 58. Ostrov N., Beal J., Ellis T., Gordon D.B., Karas B.J., Lee H.H., Lenaghan S.C., Schloss J.A., Stracquadanio G., Trefzer A.et al.. Technological challenges and milestones for writing genomes. Science. 2019; 366:310–312. [DOI] [PubMed] [Google Scholar]
  • 59. Guo Z., Yin H.Y., Ma L., Li J.Y., Ma J.J., Wu Y., Yuan Y.J.. Direct transfer and consolidation of synthetic yeast chromosomes by abortive mating and chromosome elimination. ACS Synth. Biol. 2022; 11:3264–3272. [DOI] [PubMed] [Google Scholar]
  • 60. Xu H., Han M., Zhou S., Li B.Z., Wu Y., Yuan Y.J.. Chromosome drives via CRISPR-Cas9 in yeast. Nat. Commun. 2020; 11:4344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Li L., Blankenstein T.. Generation of transgenic mice with megabase-sized human yeast artificial chromosomes by yeast spheroplast-embryonic stem cell fusion. Nat. Protoc. 2013; 8:1567–1582. [DOI] [PubMed] [Google Scholar]
  • 62. Li L.P., Lampert J.C., Chen X.J., Leitao C., Popovic J., Muller W., Blankenstein T.. Transgenic mice with a diverse human T cell antigen receptor repertoire. Nat. Med. 2010; 16:1029–1034. [DOI] [PubMed] [Google Scholar]
  • 63. Brown D.M., Chan Y.J.A., Desai P.J., Grzesik P., Oldfield L.M., Vashee S., Way J.C., Silver P.A., Glass J.I.. Efficient size-independent chromosome delivery from yeast to cultured cell lines. Nucleic Acids Res. 2017; 45:e50. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

gkad599_Supplemental_File
Click here for additional data file. (5.7MB, docx)

Data Availability Statement

All processed data are included in the manuscript or provided as supplementary data. All the whole genome sequencing data in this paper have been deposited in the NCBI database (https://www.ncbi.nlm.nih.gov/) under the BioProject ID: PRJNA984446.

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES