Abstract
Fusarium oxysporum f. sp. niveum (Fon) is a devastating soil-borne fungus causing Fusarium wilt in watermelon. The present study investigated the biochemical mechanism underlying the antifungal activity exhibited by the antagonistic bacterial strain DHA41, particularly against Fon. Molecular characterization based on the 16S rRNA gene confirmed that DHA41 is a strain of Bacillus subtilis, capable of synthesizing antifungal lipopeptides, such as iturins and fengycins, which was further confirmed by detecting corresponding lipopeptide biosynthesis genes, namely ItuB, ItuD, and FenD. The cell-free culture filtrate and extracellular lipopeptide extract of B. subtilis DHA41 demonstrated significant inhibitory effects on the mycelial growth of Fon, Didymella bryoniae, Sclerotinia sclerotiorum, Fusarium graminearum, and Rhizoctonia solani. The lipopeptide extract showed emulsification activity and inhibited Fon mycelial growth by 86.4% at 100 µg/mL. Transmission electron microscope observations confirmed that the lipopeptide extract disrupted Fon cellular integrity. Furthermore, B. subtilis DHA41 emitted volatile organic compounds (VOCs) that exhibited antifungal activity against Fon, D. bryoniae, S. sclerotiorum, and F. graminearum. These findings provide evidence that B. subtilis DHA41 possesses broad-spectrum antifungal activity against different fungi pathogens, including Fon, through the production of extracellular lipopeptides and VOCs.
Keywords: antifungal activity, Fusarium oxysporum f. sp. niveum, lipopeptide, soil-borne pathogens, volatile organic compounds
1. Introduction
Soil-borne fungi belonging to the Fusarium, Rhizoctonia, Sclerotinia, and Verticillium genera can cause root rot, vascular wilt, damping-off, and sclerotinia stem rot diseases in economically important crops, including vegetables, rice, wheat, cotton, and fruits [1]. Among them, the Fusarium oxysporum species complex can infect more than 150 crop species, including watermelon, tomato, melon, and cotton, and cause severe vascular Fusarium wilt diseases, leading to serious yield loss worldwide [2]. For example, F. oxysporum f. sp. niveum (Fon) causes the most destructive vascular wilt in watermelon, resulting in 30–50% yield losses [3]. Chemical pesticides have become ineffective due to their narrow spectrum activity and non-target environmental impacts, rendering them less effective in disease control. Furthermore, soil-borne fungi can thrive and persist by forming resting structures for extended periods [1], posing challenges to infection prevention. Therefore, soil-borne phytopathogenic fungi have long been a serious threat to sustainable agricultural production, emphasizing the development of novel eco-friendly green strategies to manage these fungal diseases in crops effectively.
Biological control of soil-borne plant diseases using beneficial microbes and their active metabolites is an effective and sustainable alternative to chemical pesticides [4,5]. Among these beneficial microbes, bacterial strains from the genus Bacillus, such as Bacillus subtilis, Bacillus velezensis, and Bacillus amyloliquefaciens, have been extensively exploited for their potentials in managing soil-borne fungal diseases [6,7,8,9]. Different Bacillus species (spp.) have been shown to possess significant antagonistic activity against soil-borne pathogenic fungi, including Fusarium spp., S. sclerotiorum, and R. solani [10,11,12,13,14,15,16]. Importantly, numerous Bacillus spp. have shown great potential in controlling Fusarium wilt in different crops [17]. Notably, B. subtilis, B. velezensis, Bacillus tequilensis, and Bacillus licheniformis have demonstrated the ability to protect watermelon, cucumber, tomato, flax, and banana from Fusarium wilt [12,16,18,19,20,21]. For example, B. velezensis F21 significantly suppressed watermelon Fusarium wilt, reducing the disease incidence in the greenhouse (80%) and in the field (66%) [19], resulting in improved crop yield and quality in an eco-friendly and cost-effective manner. Similarly, B. amyloliquefaciens DHA55 protected watermelon plants against Fusarium wilt under greenhouse conditions, suppressing disease incidence up to 75% [16]. These facts highlight the promising biocontrol potential of Bacillus spp. against devastating soil-borne diseases in crops; however, their underlying action mechanisms need to be dissected.
Bacillus spp. employ various direct and indirect mechanisms to protect plants against soil-borne pathogens, including the secretion of hydrolytic enzymes (e.g., chitinase, protease, and β-1,3-gucanse), the production of antimicrobial metabolites, and the priming of plant-induced systemic resistance (ISR) [7,17]. B. subtilis and B. licheniformis secrete extracellular chitinase and protease against F. oxysporum, inhibiting mycelial growth [13,22,23]. B. cereus, B. subtilis, and B. fortis were found to activate ISR against Fusarium wilt in tomato and banana through their regulation of jasmonic acid-, ethylene-, and brassinosteroid-mediated defense signaling pathways [24,25,26,27,28]. However, the production of extracellular antifungal metabolites by Bacillus spp., particularly non-ribosomally synthesized lipopeptides and volatile organic compounds (VOCs), is the primary disease-suppressive mechanism that directly inhibits soil-borne pathogens [29,30,31,32,33,34,35]. Extracellular lipopeptides, including iturins, fengycins, bacillomycin, and surfactins, are widely distributed in Bacillus spp. [29,31]. Iturin A and fengycins from B. amyloliquefaciens and B. velezensis have been shown to significantly inhibit the mycelial growth of F. oxysporum f. sp. niveum (Fon), F. oxysporum f. sp. lycopersici, R. solani, and S. sclerotiorum [16,36,37,38,39]. Furthermore, B. amyloliquefaciens and Bacillus mycoides BM02 have been discovered to emit VOCs to inhibit the mycelial growth and spore germination of F. oxysporum and S. sclerotiorum [40,41,42,43]. These extracellular lipopeptides and VOCs produced by Bacillus spp. hold potential as biopesticides for managing soil-borne crop diseases [31,33].
Fusarium wilt, caused by Fon, poses a serious threat to the watermelon industry, particularly in the greenhouse monocropping system [44,45]. We previously initiated an effort to develop novel sustainable biocontrol strategies for managing watermelon Fusarium wilt and characterized six antagonistic bacterial strains, including DHA41, that demonstrated strong antifungal activity against different phytopathogenic fungi, including Fon, and effectively suppressed watermelon Fusarium wilt in greenhouse experiments [16]. In this study, we investigated the biochemical basis underlying the antifungal activity of strain DHA41. Our findings suggest that the DHA41 strain produces three families of lipopeptides and emits VOCs, enabling it to exhibit antifungal activity against soil-borne pathogenic fungi such as Fon, Didymella bryoniae, R. solani, Fusarium graminearum, and S. sclerotiorum.
2. Materials and Methods
2.1. Growth Conditions for Bacterial Strain DHA41 and Fungal Pathogens
Bacterial strain DHA41 was isolated from watermelon rhizosphere soil using the serial dilution method and cultured on a Luria–Bertani (LB) plate at 28 ± 2 °C, as described previously [16]. Fungal pathogens, including F. oxysporum f. sp. Niveum (Fon), F. graminearum (Fg), D. bryoniae (Db), R. solani (Rs), and S. sclerotiorum (Ss), were collected from the Crop Diseases and Insect Pests Laboratory of MARA at Zhejiang University and maintained on potato dextrose agar (PDA) at 28 ± 2 °C [16]. For sporulation, Fon was cultured in a mung bean liquid medium at 28 ± 2 °C with shaking (150 rpm) for 2 d, and spores were collected and adjusted to a final concentration of 4 × 106 spores/mL [16].
2.2. Amplification of 16S rRNA and Lipopeptide Biosynthesis Genes
Bacterial strain DHA41 was cultured in liquid LB medium under shaking (180 rpm) at 28 ± 2 °C for 12 h. The bacterial cells were collected by centrifugation, and genomic DNA was extracted using the Takara MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 (Takara, Dalian, China), following the given instructions. Fragments of the 16S rRNA and the lipopeptide biosynthesis genes, namely ItuB, ItuD, and FenD, were amplified using gene-specific primers (Table 1). The 16S rRNA gene amplicon was sequenced commercially (Zhejiang YouKang Biotech, Hangzhou, China), aligned using the ClustalX program [46], and subjected to phylogenetic analysis using MEGA 11.0 software, following the neighbor joining (NJ) method [47].
Table 1.
The primers used in this study.
| Genes | Primers | Sequences (5′-3′) | Size (bp) | References |
|---|---|---|---|---|
| 16S rRNA | 27F | AGAGTTTGATCATGGCTCAG | 1081 | [48] |
| 1479R | TACGGTTACCTTGTTACGACTT | |||
| ItuB | BamB2F | CGACATACAGTTCTCCCCGGT | 461 | [49] |
| BamB2R | AAGAAGGCGTTTTTCAAGCA | |||
| ItuD | ItuD1F | GACGGTAGATTCGCTGCTGT | 583 | [49] |
| ItuD1R | TGATGCGATCTCCTTGGATG | |||
| FenD | FNDF2 | CTGGGAGGTCAGCCGGTCTG | 216 | [49] |
| FNDR2 | GTGGTCGCCGGTTCACAAAT |
2.3. Characterization of Cellular Fatty Acids
Bacterial strain DHA41 was cultivated on Tryptic soy agar (Difco Laboratories, Sparks, MD, USA) at 28 ± 2 °C for 24 h. Fatty acid methyl esters (FAMEs) were prepared and analyzed following the protocol of the Sherlock microbial identification system [50]. Briefly, fatty acids were released from the bacterial cells through saponification with NaOH and esterified with 6 N HCl to generate FAMEs. The FAME-containing upper layer was then collected using a methyl tert-butyl ether and hexane solution (1:1, v/v). The FAME profiling was conducted using a Hewlett Packard 5890 Series gas chromatography machine (Ramsey, MN, USA). The fatty acids were identified and quantified by comparing the retention time and peak area with an authentic standard fatty acid mixture (Sigma-Aldrich, St. Louis, MO, USA) as well as with the RTSBA6 6.10 library of bacterial fatty acids [50].
2.4. Extraction, Purification, and Characterization of Extracellular Lipopeptides from DHA41
Bacterial strain DHA41 was grown in 100 mL liquid LB medium at 28 ± 2 °C with shaking (200 rpm) for 72 h. The culture was centrifuged (12,000 rpm) at 4 °C for 20 min, and the resultant supernatant was collected. The supernatant was acidified by adding 2 M HCl (pH 2.0) and incubated overnight at 4 °C. Lipopeptide precipitates were collected through centrifugation (15,000 rpm) and resuspended in a methanol and water solution (2:1, v/v). The lipopeptide extract was dried in a rotary vacuum at 40 °C, re-dissolved in dimethyl sulfoxide (DMSO), and stored at −20 °C for further investigation.
Matrix-assisted laser desorption/ionization–time-of-flight mass spectrometry (MALD-TOF-MS) analysis was used to identify the lipopeptides of strain DHA41 [51]. A single colony of bacterial strain DHA41 was picked and homogenized in a matrix solution, as described previously [16]. After centrifugation (12,000 rpm) for 20 min at 4 °C, 1 μL of the resulting supernatant was spotted onto a MALDI-TOF-MS target plate (Bruker Daltonik, Bremen, Germany) and air-dried. The samples were analyzed using an Ultraflex MALDI-TOF-MS spectrometer equipped with a smartbeam laser (Daltonics, Bremen, Germany) for desorption and ionization with a nitrogen laser at 337 nm. The obtained spectra were analyzed to identify different lipopeptides in the extract, with the molecular weight ranging from 800 to 3000 Daltons (Da).
2.5. Evaluation of Emulsification Index
The emulsification index was evaluated following a previous protocol [52]. Briefly, bacterial strain DHA41 was grown in 100 mL liquid LB medium at 28 ± 2 °C with shaking (200 rpm) for 72 h. A cell-free supernatant (2 mL) was obtained after centrifugation (12,000 rpm) and mixed with 3 mL of hydrophobic compounds (sunflower oil, mineral oil, and toluene) or a sodium dodecyl sulfate (0.1 g/L; Sigma-Aldrich, St. Louis, MO, USA) and Triton X-100 solutions (0.1%, v/v; Sigma-Aldrich, St. Louis, MO, USA) as controls. The mixture was thoroughly vortexed for 2 min and left at room temperature for 24 h. The height of the stable emulsion layer was measured, and the emulsification index (%) was calculated by comparing the height of the emulsified layer to the total height of the liquid.
2.6. Antifungal Activity of Cell-Free Supernatant, Lipopeptide Extract, and VOCs of DHA41
The antifungal activity of the cell-free supernatant of strain DHA41 and its lipopeptide extract was examined using the well culture method [53,54], with minor modifications. The filter-sterilized cell-free supernatant (30 µL), obtained from a 2-day-old culture of strain DHA41, and 30 µg/mL of lipopeptide extract (60 µL) were poured into the wells (5 mm) of the PDA plates, which were then inoculated with fungal mycelial plugs (5 mm in diameter). The wells supplemented with a similar volume of sterile LB medium or DMSO were used as controls, followed by incubations at 28 ± 2 °C for 5 d. To estimate growth inhibition rate, the colony diameters grown in the treated plates were compared to those grown in the control plates.
The effect of VOCs produced by DHA41 on the tested fungi was also examined using the two-sealed-base-plates method as previously described [55]. Briefly, bacterial strain DHA41 was streaked onto the LB medium on one base plate, while fungal mycelial discs (5 mm in diameter) were placed on PDA on another base plate. The two plates were then tightly assembled face-to-face and sealed with three layers of Parafilm and incubated at 28 ± 2 °C for 3–5 d. Two-plate assemblies without inoculation of strain DHA41 served as controls. The growth inhibition rate was calculated by comparing the colony diameters grown in the presence of strain DHA41 to those grown on the control plates.
2.7. Minimal Inhibitory Concentration Assay
The minimal inhibitory concentration (MIC) of the lipopeptide extract against Fon was determined as previously described [16]. Briefly, Fon inoculum (50 µL) was added to the wells of a 96-well microtiter plate, followed by supplementation with varying levels of lipopeptide extract (50, 75, 100, 200, and 300 µg/mL). Control wells were supplied with DMSO. After incubation at 28 ± 2°C for 24 h, the optical density at 600 nm (OD600) was measured. To calculate the growth inhibition rate, the OD600 values in the lipopeptide-supplemented wells were compared to that in the control wells.
2.8. Microscopic Observation
The effect of lipopeptide extract on Fon cell viability was examined by staining using fluorescein diacetate (FDA) and propidium iodide (PI), as previously described [56,57]. In these experiments, live fungal cells exhibited green fluorescence, while dead cells showed red fluorescence. After treating the Fon inoculum with lipopeptide extract (30 µg/mL) for 12 h, fungal mycelia were collected and resuspended in DMSO, followed by staining with fluorescent dyes (FDA and PI) at room temperature for 15 min under dark conditions. The stained mycelia were observed with a Zeiss LSM 880 laser confocal microscope (Jena, Germany).
The effect of the lipopeptide extract on Fon mycelial and conidial cellular structure was examined using transmission electron microscopy (TEM, model H-7650, Hitachi, Tokyo, Japan), as previously described [57,58]. The Fon inoculum (1 mL) was treated with lipopeptide extract (30 µg/mL) and incubated with shaking (150 rpm) at 28 ± 2 °C for 12 h. The samples were then immersed in 2.5% glutaraldehyde overnight, rinsed three times for 15 min with 0.1 M phosphate buffer (pH 7.0), and post-fixed in OsO4 in the phosphate buffer (1%, w/v) for 2 h. The samples were dehydrated in an ethanol grade (30–70%) for 15 min at each concentration and finally dehydrated twice in absolute acetone for 20 min. The dehydrated samples were embedded in Spurr resin and polymerized for 12 h at 70 °C. Ultrathin sections of the samples were stained with uranyl acetate and lead citrate and observed using the H-7650 TEM.
2.9. Statistical Analysis
The experiments in this study were independently conducted three times, and at least three replicates were included for each treatment in an independent experiment. Data from three independent experiments were subjected to statistical analysis using the Tukey’s least significant difference (LSD) method to determine the statistical significance among the treatments at a 95% confidence level in SPSS 14.0 software.
3. Results
3.1. Molecular and Biochemical Characterization of B. subtilis DHA41
To characterize strain DHA41, a 1081 bp fragment of the 16S rRNA gene was amplified and sequenced. In the phylogenetic tree, the 16S rRNA gene sequence was closely grouped with B. subtilis (ON413867 and MW847630.1) and showed >97% similarity to the 16S rRNA genes of these closely-related groups (Figure 1). For biochemical characterization, the fatty acid composition of strain DHA41 was analyzed, revealing 16:0 (15.42%), 15:0 iso (24.55%), 15:0 anteso (34.10%), 17:0 iso (6.65%), and 17:0 anteso (5.20%) as the most abundant saturated fatty acids (Table 2). This fatty acid composition is similar to those in reported Bacillus spp. [59,60], confirming that the DHA41 strain belongs to the genus Bacillus. Overall, the molecular phylogenetic relationship suggests the taxonomic identity of the bacterial strain DHA41 as Bacillus subtilis.
Figure 1.
Molecular characterization of the antagonistic bacterial strain DHA41. The phylogenetic tree of strain DHA41’s 16S rRNA gene (bold text), with those from other Bacillus species, was constructed using the neighbor joining method with a 1000-bootstrap approach. The Escherichia coli 16S rRNA gene sequence (MN318323.1) was used as an outgroup in the tree. The scale bar indicates that the sequences represented in the tree differ by an average of 0.050 nucleotide substitutions per site.
Table 2.
The composition of fatty acids in B. subtilis DHA41.
| Fatty Acids (FA) | Content (%) |
|---|---|
| Saturated straight chain FA | |
| 12:0 | -- |
| 14:0 | 2.67 |
| 16:0 | 15.42 |
| 18:0 | 0.54 |
| Saturated terminally branched FA | |
| 13:0 iso | 0.51 |
| 14:0 iso | 1.55 |
| 15:0 iso | 24.55 |
| 16:0 iso | 1.79 |
| 17:0 iso | 6.65 |
| 15:0 anteso | 34.10 |
| 17:0 anteso | 5.20 |
| Monounsaturated FA | |
| 16:1 w11c | 4.06 |
| 17:1ω10c iso | 1.46 |
3.2. Identification of Extracellular Lipopeptides Produced by B. subtilis DHA41
The extracellular lipopeptides produced by B. subtilis DHA41 were characterized by MALDI-TOF-MS analysis, showing multiple spectral peaks that typically corresponded to three families of non-ribosomal lipopeptides, including iturins (1079.54 m/z, 1095.52 m/z, and 1093.884 m/z), surfactins (1044.961 m/z, 1030.959 m/z, and 1065.859 m/z), and fengycins (1058.60 m/z and 1074.97 m/z) (Figure 2). Furthermore, specific bands for genes involved in iturin- (ItuB and ItuD) and fengycin (FenB) biosynthesis, two well-known antifungal lipopeptide families, were PCR amplified using the selected primer pairs from the genomic DNA of B. subtilis DHA41 (Figure 3A). These data indicate that B. subtilis DHA41 possesses the inherent genetic potential for producing different extracellular lipopeptides.
Figure 2.
Identification of extracellular lipopeptides produced by B. subtilis DHA41 by matrix-assisted laser desorption/ionization–time-of-flight mass spectrometry.
Figure 3.
Detection of the lipopeptide biosynthesis genes in B. subtilis DHA41 (A) and analysis of the emulsification index of B. subtilis DHA41 on different organic oil substrates (B). The amplicon sizes are indicated above the bands in (A).
The emulsification index was analyzed to further confirm the presence of biosurfactants in the lipopeptide extract from B. subtilis DHA41. The lipopeptide extract showed emulsifying activity against two hydrophobic substrates, including mineral oil (31.25 ± 0.03%) and sunflower oil (51 ± 0.50%) (Figure 3B and Table 3). Interestingly, the lipopeptide extract did not show emulsifying activity against toluene (Figure 3B and Table 3). These results indicate that B. subtilis DHA41 is capable of producing extracellular biosurfactants in response to specific organic compounds.
Table 3.
Emulsification index of lipopeptide extract from B. subtilis DHA41 on different organic oil substrates.
| Mineral Oil | Sunflower Oil | Toluene |
|---|---|---|
| 51 ± 0.50 | 31.25 ± 0.03 | nd |
nd, not detectable.
3.3. Antifungal Effect of Cell-Free Filtrate and Extracellular Lipopeptides of B. subtilis DHA41
The results of the antifungal activity of the cell-free supernatant of B. subtilis DHA41 against different pathogenic fungi showed significant inhibition of Fon, Ss, and Db mycelial growth (Figure 4A), with inhibition rates of 89.81%, 85.92%, and 86.06%, respectively, compared to the controls (Figure 4B). These results indicate the presence of potent antimicrobial compounds in the cell-free supernatant of B. subtilis DHA41 that effectively inhibit the mycelial growth of pathogenic fungi.
Figure 4.
Antifungal activity of cell-free supernatant from B. subtilis DHA41 culture against F. oxysporum f. sp. nevium (Fon), S. sclerotiourm (Ss), and D. byroniae (Db). (A) Fungal colonies grown on potato dextrose agar supplemented with 60 µL of cell-free supernatant or sterile Luria–Bertani medium. (B) The inhibition rate of the cell-free supernatant against Fon, Ss, and Db. The experiment in (A) was independently performed three times with similar results. The data presented in (B) are the means ± standard deviation from three independent experiments. Different letters above the columns indicate a significant difference at 95% confidence level according to the one-way analysis of variance test.
Next, inhibition zones were observed around the lipopeptide-supplemented wells for Fon, Ss, Db, Rs, and Fg colonies compared to the DMSO-supplemented control wells (Figure 5A). The largest inhibition zone was observed for Rs (11.50 ± 0.70 mm), followed by Fon (10.33 ± 0.47 mm), Ss (10.33 ± 0.47 mm), Db (8.66 ± 0.47 mm), and Fg (6.83 ± 0.62 mm) (Figure 5B). Furthermore, the MIC of the lipopeptide extract against Fon was determined. The extracellular lipopeptide extract at 100 µg/mL exhibited the highest inhibition rate (86.4%) against Fon (Figure 5C). However, Fon growth inhibition rate was decreased at higher concentrations of the lipopeptide extract (200 and 300 µg/mL) compared to 100 µg/mL (Figure 5C). The observed non-linear antifungal activity of the lipopeptide extract at higher concentrations might be attributed to the saturation effect and hormesis or a dose-dependent response. These results collectively indicate that the extracellular lipopeptide extract of B. subtilis DHA41 possesses significant antifungal activity against multiple phytopathogenic fungi, including Fon.
Figure 5.
Antifungal activity of extracellular lipopeptide extract from B. subtilis DHA41 against F. oxysporum f. sp. nevium (Fon), S. sclerotiourm (Ss), D. byroniae (Db), R. solani (Rs), and F. graminearum (Fg). (A) Fungal colonies grown on potato dextrose agar supplemented with the extracellular lipopeptide extract (LP) or dimethyl sulfoxide (CK). (B) The inhibition zones of the LP against Fon, Ss, Db, Rs, and Fg. (C) The inhibition activity of different concentrations of the LP on Fon growth. The experiment in (A) was independently performed three times with similar results. The data presented in (B,C) are the means ± standard deviation from three independent experiments. Different letters above the columns indicate a significant difference at 95% confidence level according to the one-way analysis of variance test.
3.4. Extracellular Lipopeptides Disrupt Fon Cellular Integrity
The cell viability assays using FDA and PI staining [61,62] revealed that the untreated Fon mycelia and conidia exhibited normal morphology and intact structures, as evidenced from strong FDA-generated green fluorescent signals (Figure 6A,B). However, extracellular lipopeptide extract (30 µg/mL)-treated Fon mycelia and conidia showed PI-generated red fluorescence, revealing damaged morphology and collapsed structures (Figure 6).
Figure 6.
B. subtilis DHA41-produced lipopeptides affect cell viability in F. oxysporum f. sp. niveum. Lipopeptide extract- (30 µg/mL) or dimethyl sulfoxide-treated (CK) Fon mycelia (A) and conidia (B) were stained with fluorescein diacetate (FDA) and propidium iodide (PI) for 12 h, followed by detection of fluorescent signals using a Zeiss LSM 880 confocal laser microscope, with excitation at 488 nm for FDA and 561 nm for PI. Scale bar, 10 µm. The experiments were independently performed three times with similar results, and data from one representative experiment are shown.
Further, the ultrastructure studies demonstrated that the untreated mycelia and conidia showed intact cellular morphology and structures, such as cellular membranes and cytoplasm, while mycelia and conidia treated with the lipopeptide extract displayed abnormal morphology and structure, as revealed by shrinking of the cytoplasm, plasma membrane damage, and cell wall disintegration (Figure 7). These data indicate that the extracellular lipopeptide extract of B. amyloliquefaciens DHA41 can disrupt Fon integrity, leading to cellular damage and decreased viability.
Figure 7.
Ultrastructural changes in mycelia and conidia of F. oxysporum f. sp. niveum after treatment with B. subtilis DHA41-produced lipopeptide extract (30 µg/mL). Mycelia (A) and conidia (B) of Fon were treated with lipopeptide extract or dimethyl sulfoxide (CK) for 12 h and then examined under a transmission electron microscope (TEM). Scale bars, representing 2 μm in (A) and 1 μm in (B), respectively, are shown at the bottom of the TEM images. The experiments were independently performed three times with similar results, and data from one representative experiment are shown.
3.5. Antifungal Effect of the VOCs of B. subtilis DHA41
Bacillus spp. are well-known for producing diverse antifungal VOCs [32,35]. In this study, the results revealed that Fon, Ss, Db, and Fg growth was significantly reduced when co-cultivated with B. subtilis DHA41, compared to the controls without strain DHA41 (Figure 8A). Among the tested fungi co-cultured with B. subtilis DHA41, Fon displayed the smallest colony growth (3.0 ± 0.4 cm), followed by Db (5.01 ± 0.23 cm), Ss (6.03 ± 0.41 cm), and Fg (7.0 ± 0.7 cm), leading to growth inhibition rates of 62.3 ± 5.1%, 35.4 ± 2.9%, 24.6 ± 5.1%, and 14.6 ± 7.8%, respectively (Figure 8B,C). These results indicate that B. subtilis DHA41 emits antifungal VOCs, inhibiting the radial growth of various soil-borne pathogenic fungi, such as Fon, Fg, Db, and Ss.
Figure 8.
Antifungal activity of B. subtilis DHA41-emitted volatile organic compounds against F. oxysporum f. sp. nevium (Fon), F. graminearum (Fg), D. byroniae (Db), and S. sclerotiourm (Ss). (A) Fungal colonies grown with or without B. subtilis DHA41 in the two-sealed-base-plate experiments. (B) Colony sizes of the tested fungi grown with B. subtilis DHA41. (C) Inhibition rates of colony growth of the tested fungi grown with B. subtilis DHA41. The experiment in (A) was independently performed three times with similar results. The data presented in (B,C) are the means ± standard deviation from three independent experiments. Different letters above the columns indicate a significant difference at 95% confidence level according to the one-way analysis of variance test.
4. Discussion
Biological control has become crucial in integrated crop disease management systems [17,63,64,65]. Recent studies have shown that manipulating the soil microbiomes with plant-beneficial bacterial species suppressed Fusarium wilt in watermelon [66]. Several beneficial bacterial strains, such as Paenibacillus polymyxa, Pseudomonas fluorescens, Streptomyces goshikiensis, and Bacillus spp., have demonstrated efficacy in controlling Fusarium wilt in watermelon [67,68,69]. Particularly, strains of B. subtilis, B. amyloliquefaciens, B. velezensis, and B. methylotrophicus have showed significant antifungal activity against Fon and effectively suppressed Fusarium wilt in watermelon [19,36,38,70,71,72,73,74]. However, the underlying mechanisms of watermelon Fusarium wilt suppression by these beneficial bacterial strains remain unclear. We previously characterized six antagonistic bacterial strains, including DHA41, against various soil-borne pathogenic fungi, including Fon, which successfully suppressed watermelon Fusarium wilt in greenhouse experiments [16]. The present study investigated the biocontrol mechanism of DHA41, which synthesized antifungal bioactive compounds, including extracellular lipopeptides and VOCs, showing significant inhibitory activities against Fon and other tested soil-borne fungal pathogens.
In our previous study, DHA41 was shown to be a gram-positive rod-shaped bacterial strain capable of producing catalase, protease, cellulase, ammonium, indole-3-acetic acid, siderophore, and solubilizing inorganic phosphate [16]. Phylogenetic analysis of 16S rRNA and fatty acid profiling confirmed that strain DHA41 belongs to B. subtilis (Figure 1 and Table 2). Notably, B. subtilis DHA41 exhibited high levels of 16:0, 15:0 iso, and 15:0 anteso fatty acids, which aligns with the typical fatty acid composition commonly found in Bacillus spp. [59,60].
It has previously been discovered that the non-ribosomally synthesized extracellular lipopeptides are associated with the antimicrobial activity and biocontrol of plant diseases by Bacillus spp. [29,31]. Generally, Bacillus spp. produce three families of lipopeptides, including surfactins, fengycins, and iturins [29]. In the present study, MALDI-TOF-MS analysis identified three isoforms of iturins, three isoforms of surfactins, and two isoforms of fengycins (Figure 2), indicating the genetic diversity of B. subtilis DHA41 to produce extracellular lipopeptides. This result is further confirmed by detecting ItuB, ItuD, and FenB genes in B. subtilis DHA41 (Figure 3A). Comparative genomic studies have shown that B. subtilis strains harbor 11 putative large biosynthetic gene clusters, some of which are responsible for lipopeptide production [75]. Recent studies have also highlighted variations in the production of non-ribosomally synthesized lipopeptides among different B. subtilis strains isolated from the same soil sample [76]. For example, analysis of 330 biosynthetic clusters from B. subtilis and their lipopeptides revealed a species-specific pattern of lipopeptide production [77]. Furthermore, B. subtilis DHA41 exhibited significant emulsification activity against some organic oils, such as mineral oil and sunflower oil (Figure 3B and Table 2), which coincides with previous studies where lipopeptide biosurfactants from Bacillus thuringiensis pak2310 showed emulsification and antifungal activity against F. oxysporum [78]. The emulsification activity is known to contribute to adhesion, bioavailability, desorption, and antimicrobial activity in natural environments [79]. Collectively, the diverse extracellular lipopeptides and emulsification activity play an important role in the antifungal activity and disease-suppressing ability of B. subtilis DHA41.
The cell-free supernatant and extracellular lipopeptide extract of B. subtilis DHA41 exhibited significant broad-spectrum antifungal activity against Fon, Db, Ss, Rs, and Fg (Figure 4A,B). This finding is consistent with previous observations showing that lipopeptide extracts from B. subtilis SCB-1 and B. amyloliquefaciens CNU114001 showed antifungal activity against diverse fungal pathogens, including F. oxysporum and Ss [80,81]. The lipopeptide extract from B. subtilis DHA41 had a notable impact on the viability of mycelia and conidia of Fon (Figure 6), leading to disruptions in cellular structure and integrity (Figure 7). These observations align with previous results demonstrating that lipopeptides from B. velezensis and B. amyloliquefaciens caused morphological changes in Fon, such as cytoplasmic shrinkage, aggregation of organelles, and damage to plasma membranes and cell walls [36,38,53,71]. Furthermore, the Bacillus spp.-produced lipopeptides enter Fon cells through endocytosis [82], subsequently targeting intracellular molecules and triggering metabolic alterations, thus exerting the antifungal effects against Fon [72,83].
In addition to extracellular lipopeptides, antagonistic bacteria also emit a wide range of VOCs [32,35]. These VOCs are low molecular weight compounds that readily emit under normal environmental conditions and exhibit significant antimicrobial activity [33]. In this study, co-incubation of Fon, Db, Ss, and Fg with B. subtilis DHA41 significantly inhibited the mycelial growth of fungal pathogens, implying the production of VOCs by B. subtilis DHA41 (Figure 8). Notably, B. subtilis DHA41-emitted VOCs exhibited varying levels of inhibition against the tested fungal pathogens. B. subtilis, B. amyloliquefaciens, and B. mycoides have been reported to release antifungal VOCs, inhibiting the mycelial growth and spore germination rate of Fon, F. oxysporum f. sp. lycopersici, F. oxysporum f. sp. cubense, F. oxysporum f. sp. radicis-lycopersici, and Ss [40,41,42,43,84]. For example, B. amyloliquefaciens L3-produced VOCs, including 2-heptanone, 2-ethyl-1-hexano, and 2-nonanone, completely inhibited Fon mycelial growth [40]. VOCs of antagonistic bacteria have been shown to improve plant growth and trigger induced systemic resistance in plants [33]; for example, albuterol and 1,3-propanediole, two volatile organic compounds produced by B. subtilis SYST2, and acetoin and 2,3-butanediol, produced by B. amyloliquefaciens L3, promoted the growth of tomato and Arabidopsis plants [73,85]. However, the chemical nature of the B. subtilis DHA41-produced VOCs and their involvement in promoting plant growth and suppressing Fusarium wilt in watermelon [16] need further investigation.
5. Conclusions
In this study, we found that the antagonistic bacterium B. subtilis DHA41 produces three families of extracellular lipopeptides, including iturins, surfactins, and fengycins, which exhibited significant antifungal activity against five soil-borne phytopathogenic fungi, including Fon, Db, Ss, Rs, and Fg. The extracellular lipopeptide extract of B. subtilis DHA41 effectively inhibited the mycelial growth and spore germination of Fon by disrupting cellular structure and integrity. Furthermore, B. subtilis DHA41 emitted VOCs that displayed inhibitory effects on the mycelial growth of Fon, Db, Ss, and Fg. Our findings highlight the biocontrol capacity of B. subtilis DHA41 in combating Fusarium wilt in watermelon through the production of diverse extracellular lipopeptides and VOCs. The ability of B. subtilis DHA41 to promote plant growth and suppress Fusarium wilt in watermelon, along with the antifungal activity of its active secondary metabolites, suggests the possibility of developing B. subtilis DHA41-based biopesticides for the protection of important crops against soil-borne diseases under field conditions.
Author Contributions
Conceptualization, F.S. and D.M.K.A.-M.; methodology, D.L. and D.M.K.A.-M.; formal analysis, F.S. and D.M.K.A.-M.; investigation, D.M.K.A.-M., M.N., N.S.A.A. and H.H.Q.; data curation, D.M.K.A.-M. and F.S.; writing—original draft preparation, D.M.K.A.-M. and F.S.; writing—review and editing, F.S. and M.N.; funding acquisition, F.S. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All the data are present inside the manuscript file.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This research was funded by the China Agriculture Research System of MOF and MARA of China (Grant no. CARS-25).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Coque J.J.R., Álvarez-Pérez J.M., Cobos R., González-García S., Ibáñez A.M., Diez Galán A., Calvo-Peña C. Advances in the control of phytopathogenic fungi that infect crops through their root system. Adv. Appl. Microbiol. 2020;111:123–170. doi: 10.1016/bs.aambs.2020.01.003. [DOI] [PubMed] [Google Scholar]
- 2.Gordon T.R. Fusarium oxysporum and the Fusarium wilt syndrome. Annu. Rev. Phytopathol. 2017;55:23–39. doi: 10.1146/annurev-phyto-080615-095919. [DOI] [PubMed] [Google Scholar]
- 3.Lü G., Guo S., Zhang H., Geng L., Song F., Fei Z., Xu Y. Transcriptional profiling of watermelon during its incompatible interaction with Fusarium oxysporum f. sp. niveum. Eur. J. Plant Pathol. 2011;131:585–601. doi: 10.1007/s10658-011-9833-z. [DOI] [Google Scholar]
- 4.Mazzola M., Freilich S. Prospects for biological soilborne disease control: Application of indigenous versus synthetic microbiomes. Phytopathology. 2017;107:256–263. doi: 10.1094/PHYTO-09-16-0330-RVW. [DOI] [PubMed] [Google Scholar]
- 5.Bonaterra A., Badosa E., Daranas N., Francés J., Roselló G., Montesinos E. Bacteria as biological control agents of plant diseases. Microorganisms. 2022;10:1759. doi: 10.3390/microorganisms10091759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Khan A.R., Mustafa A., Hyder S., Valipour M., Rizvi Z.F., Gondal A.S., Yousuf Z., Iqbal R., Daraz U. Bacillus spp. as bioagents: Uses and application for sustainable agriculture. Biology. 2022;11:1763. doi: 10.3390/biology11121763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Blake C., Christensen M.N., Kovács Á.T. Molecular aspects of plant growth promotion and protection by Bacillus subtilis. Mol. Plant-Microbe Interact. 2021;34:15–25. doi: 10.1094/MPMI-08-20-0225-CR. [DOI] [PubMed] [Google Scholar]
- 8.Hashem A., Tabassum B., Fathi Abd Allah E. Bacillus subtilis: A plant-growth promoting rhizobacterium that also impacts biotic stress. Saudi J. Biol. Sci. 2019;26:1291–1297. doi: 10.1016/j.sjbs.2019.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Luo L., Zhao C., Wang E., Raza A., Yin C. Bacillus amyloliquefaciens as an excellent agent for biofertilizer and biocontrol in agriculture: An overview for its mechanisms. Microbiol. Res. 2022;259:127016. doi: 10.1016/j.micres.2022.127016. [DOI] [PubMed] [Google Scholar]
- 10.Baard V., Bakare O.O., Daniel A.I., Nkomo M., Gokul A., Keyster M., Klein A. Biocontrol potential of Bacillus subtilis and Bacillus tequilensis against four Fusarium species. Pathogens. 2023;12:254. doi: 10.3390/pathogens12020254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Rafiee F., Reza Fazeli M., Akhavan Sepahi A., Noormohammadi Z. Isolation, screening and identification of native and new Bacillus subtilis with strong antifungal compound against Fusarium oxysporum. Biocontrol Sci. 2022;27:201–208. doi: 10.4265/bio.27.201. [DOI] [PubMed] [Google Scholar]
- 12.Xu W., Yang Q., Yang F., Xie X., Goodwin P.H., Deng X., Tian B., Yang L. Evaluation and genome analysis of Bacillus subtilis YB-04 as a potential biocontrol agent against Fusarium wilt and growth promotion agent of cucumber. Front. Microbiol. 2022;13:885430. doi: 10.3389/fmicb.2022.885430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Luo Y., Sun L., Zhu Z., Ran W., Shen Q. Identification and characterization of an anti-fungi Fusarium oxysporum f. sp. cucumerium protease from the Bacillus subtilis strain N7. J. Microbiol. 2013;51:359–366. doi: 10.1007/s12275-013-2627-6. [DOI] [PubMed] [Google Scholar]
- 14.Cheng Y., Gao X., He H., Zhang X., Wang R., Liu J. Dual RNA sequencing analysis of Bacillus amyloliquefaciens and Sclerotinia sclerotiorum during infection of soybean seedlings by S. sclerotiorum unveils antagonistic interactions. Front. Microbiol. 2022;13:924313. doi: 10.3389/fmicb.2022.924313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Huang Y., Wu Z., He Y., Ye B.C., Li C. Rhizospheric Bacillus subtilis exhibits biocontrol effect against Rhizoctonia solani in pepper (Capsicum annuum) Biomed. Res. Int. 2017;2017:9397619. doi: 10.1155/2017/9397619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Al-Mutar A.M.A., Abduljaleel N.S., Noman M., Azizullah, Li D., Song F. Suppression of Fusarium wilt in watermelon by Bacillus amyloliquefaciens DHA55 through extracellular production of antifungal lipopeptides. J. Fungi. 2023;9:336. doi: 10.3390/jof9030336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Khan N., Maymon M., Hirsch A.M. Combating Fusarium infection using Bacillus-based antimicrobials. Microorganisms. 2017;5:75. doi: 10.3390/microorganisms5040075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Fan H., Li S., Zeng L., He P., Xu S., Bai T., Huang Y., Guo Z., Zheng S.J. Biological control of Fusarium oxysporum f. sp. cubense tropical race 4 using natively isolated Bacillus spp. YN0904 and YN1419. J. Fungi. 2021;7:795. doi: 10.3390/jof7100795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jiang C.H., Yao X.F., Mi D.D., Li Z.J., Yang B.Y., Zheng Y., Qi Y.J., Guo J.H. Comparative transcriptome analysis reveals the biocontrol mechanism of Bacillus velezensis F21 against Fusarium wilt on watermelon. Front. Microbiol. 2019;10:652. doi: 10.3389/fmicb.2019.00652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Karthika S., Remya M., Varghese S., Dhanraj N.D., Sali S., Rebello S., Jose S.M., Jisha M.S. Bacillus tequilensis PKDN31 and Bacillus licheniformis PKDL10 -As double headed swords to combat Fusarium oxysporum f. sp. lycopersici induced tomato wilt. Microb. Pathog. 2022;172:105784. doi: 10.1016/j.micpath.2022.105784. [DOI] [PubMed] [Google Scholar]
- 21.Planchon A., Durambur G., Besnier J.B., Plasson C., Gügi B., Bernard S., Mérieau A., Trouvé J.P., Dubois C., Laval K., et al. Effect of a Bacillus subtilis strain on flax protection against Fusarium oxysporum and its impact on the root and stem cell walls. Plant Cell Environ. 2021;44:304–322. doi: 10.1111/pce.13882. [DOI] [PubMed] [Google Scholar]
- 22.Swain R.C., Ray R.C., Nautiyal C.S. Biocontrol efficacy of Bacillus subtilis strains isolated from cow dung against postharvest yam (Dioscorea rotundata L.) pathogens. Curr. Microbiol. 2008;57:407–411. doi: 10.1007/s00284-008-9213-x. [DOI] [PubMed] [Google Scholar]
- 23.Essghaier B., Zouaoui M., Najjari A., Sadfi N. Potentialities and characterization of an antifungal chitinase produced by a halotolerant Bacillus licheniformis. Curr. Microbiol. 2021;78:513–521. doi: 10.1007/s00284-020-02329-0. [DOI] [PubMed] [Google Scholar]
- 24.Pazarlar S., Madriz-Ordeñana K., Thordal-Christensen H. Bacillus cereus EC9 protects tomato against Fusarium wilt through JA/ET-activated immunity. Front. Plant Sci. 2022;13:1090947. doi: 10.3389/fpls.2022.1090947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ramírez V., Martínez J., Bustillos-Cristales M.D.R., Catañeda-Antonio D., Munive J.A., Baez A. Bacillus cereus MH778713 elicits tomato plant protection against Fusarium oxysporum. J. Appl. Microbiol. 2022;132:470–482. doi: 10.1111/jam.15179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sun Y., Huang B., Cheng P., Li C., Chen Y., Li Y., Zheng L., Xing J., Dong Z., Yu G. Endophytic Bacillus subtilis TR21 improves banana plant resistance to Fusarium oxysporum f. sp. cubense and promotes root growth by upregulating the jasmonate and brassinosteroid biosynthesis pathways. Phytopathology. 2022;112:219–231. doi: 10.1094/PHYTO-04-21-0159-R. [DOI] [PubMed] [Google Scholar]
- 27.Jinal N.H., Amaresan N. Evaluation of biocontrol Bacillus species on plant growth promotion and systemic-induced resistant potential against bacterial and fungal wilt-causing pathogens. Arch. Microbiol. 2020;202:1785–1794. doi: 10.1007/s00203-020-01891-2. [DOI] [PubMed] [Google Scholar]
- 28.Akram W., Anjum T., Ali B., Ahmad A. Screening of native bacillus strains to induce systemic resistance in tomato plants against fusarium wilt in split root system and its field applications. Int. J. Agric. Biol. 2013;15:1289–1294. [Google Scholar]
- 29.Ongena M., Jacques P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008;16:115–125. doi: 10.1016/j.tim.2007.12.009. [DOI] [PubMed] [Google Scholar]
- 30.Caulier S., Nannan C., Gillis A., Licciardi F., Bragard C., Mahillon J. Overview of the antimicrobial compounds produced by members of the Bacillus subtilis group. Front. Microbiol. 2019;10:302. doi: 10.3389/fmicb.2019.00302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Penha R.O., Vandenberghe L.P.S., Faulds C., Soccol V.T., Soccol C.R. Bacillus lipopeptides as powerful pest control agents for a more sustainable and healthy agriculture: Recent studies and innovations. Planta. 2020;251:70. doi: 10.1007/s00425-020-03357-7. [DOI] [PubMed] [Google Scholar]
- 32.Poulaki E.G., Tjamos S.E. Bacillus species: Factories of plant protective volatile organic compounds. J. Appl. Microbiol. 2023;134:lxad037. doi: 10.1093/jambio/lxad037. [DOI] [PubMed] [Google Scholar]
- 33.Rani A., Rana A., Dhaka R.K., Singh A.P., Chahar M., Singh S., Nain L., Singh K.P., Minz D. Bacterial volatile organic compounds as biopesticides, growth promoters and plant-defense elicitors: Current understanding and future scope. Biotechnol. Adv. 2023;63:108078. doi: 10.1016/j.biotechadv.2022.108078. [DOI] [PubMed] [Google Scholar]
- 34.de Boer W., Li X., Meisner A., Garbeva P. Pathogen suppression by microbial volatile organic compounds in soils. FEMS Microbiol. Ecol. 2019;95:fiz105. doi: 10.1093/femsec/fiz105. [DOI] [PubMed] [Google Scholar]
- 35.Almeida O.A.C., de Araujo N.O., Dias B.H.S., de Sant’Anna Freitas C., Coerini L.F., Ryu C.M., de Castro Oliveira J.V. The power of the smallest: The inhibitory activity of microbial volatile organic compounds against phytopathogens. Front. Microbiol. 2023;13:951130. doi: 10.3389/fmicb.2022.951130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wang K., Wang Z., Xu W. Induced oxidative equilibrium damage and reduced toxin synthesis in Fusarium oxysporum f. sp. niveum by secondary metabolites from Bacillus velezensis WB. FEMS Microbiol. Ecol. 2022;98:fiac080. doi: 10.1093/femsec/fiac080. [DOI] [PubMed] [Google Scholar]
- 37.Moreno-Velandia C.A., Ongena M., Cotes A.M. Effects of fengycins and iturins on Fusarium oxysporum f. sp. physali and root colonization by Bacillus velezensis Bs006 protect golden berry against vascular wilt. Phytopathology. 2021;111:2227–2237. doi: 10.1094/PHYTO-01-21-0001-R. [DOI] [PubMed] [Google Scholar]
- 38.Wang J., Qiu J., Yang X., Yang J., Zhao S., Zhou Q., Chen L. Identification of lipopeptide produced by Bacillus amyloliquefaciens NCPSJ7 and its antifungal activities against Fusarium oxysporum f. sp. niveum. Foods. 2022;11:2996. doi: 10.3390/foods11192996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kang B.R., Park J.S., Jung W.J. Antifungal evaluation of fengycin isoforms isolated from Bacillus amyloliquefaciens PPL against Fusarium oxysporum f. sp. lycopersici. Microb. Pathog. 2020;149:104509. doi: 10.1016/j.micpath.2020.104509. [DOI] [PubMed] [Google Scholar]
- 40.Wu J.J., Huang J.W., Deng W.L. Phenylacetic acid and methylphenyl acetate from the biocontrol bacterium Bacillus mycoides BM02 suppress spore germination in Fusarium oxysporum f. sp. lycopersici. Front. Microbiol. 2020;11:569263. doi: 10.3389/fmicb.2020.569263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Massawe V.C., Hanif A., Farzand A., Mburu D.K., Ochola S.O., Wu L., Tahir H.A.S., Gu Q., Wu H., Gao X. Volatile compounds of endophytic Bacillus spp. have biocontrol activity against Sclerotinia sclerotiorum. Phytopathology. 2018;108:1373–1385. doi: 10.1094/PHYTO-04-18-0118-R. [DOI] [PubMed] [Google Scholar]
- 42.Yuan J., Raza W., Shen Q., Huang Q. Antifungal activity of Bacillus amyloliquefaciens NJN-6 volatile compounds against Fusarium oxysporum f. sp. cubense. Appl. Environ. Microbiol. 2012;78:5942–5944. doi: 10.1128/AEM.01357-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Minerdi D., Bossi S., Gullino M.L., Garibaldi A. Volatile organic compounds: A potential direct long-distance mechanism for antagonistic action of Fusarium oxysporum strain MSA 35. Environ. Microbiol. 2009;11:844–854. doi: 10.1111/j.1462-2920.2008.01805.x. [DOI] [PubMed] [Google Scholar]
- 44.Everts K.L., Himmelstein J.C. Fusarium wilt of watermelon: Towards sustainable management of a re-emerging plant disease. Crop Prot. 2015;73:93–99. doi: 10.1016/j.cropro.2015.02.019. [DOI] [Google Scholar]
- 45.Martyn R.D. Fusarium wilt of watermelon: 120 years of research. Hortic. Rev. 2014;42:349–442. [Google Scholar]
- 46.Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin F., Higgins D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tamura K., Stecher G., Kumar S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021;38:3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Li B., Xu L., Lou M., Li F., Zhang Y., Xie G.J. Isolation and characterization of antagonistic bacteria against bacterial leaf spot of Euphorbia pulcherrima. Lett. Appl. Microbiol. 2008;46:450–455. doi: 10.1111/j.1472-765X.2008.02337.x. [DOI] [PubMed] [Google Scholar]
- 49.Cao Y., Xu Z., Ling N., Yuan Y., Yang X., Chen L., Shen B., Shen Q. Isolation and identification of lipopeptides produced by B. subtilis SQR9 for suppressing Fusarium wilt of cucumber. Sci. Hortic. 2012;135:32–39. doi: 10.1016/j.scienta.2011.12.002. [DOI] [Google Scholar]
- 50.Sasser M. Identification of Bacteria by Gas Chromatography of Cellular Fatty Acids. MIDI Inc.; Newark, DE, USA: 1990. MIDI Technical Note 101. [Google Scholar]
- 51.Ayed H.B., Hmidet N., Béchet M., Chollet M., Chataigné G., Leclère V., Jacques P., Nasri M. Identification and biochemical characteristics of lipopeptides from Bacillus mojavensis A21. Process Biochem. 2014;49:1699–1707. doi: 10.1016/j.procbio.2014.07.001. [DOI] [Google Scholar]
- 52.Ali N., Wang F., Xu B., Safdar B., Ullah A., Naveed M., Wang C., Rashid M.T. Production and application of biosurfactant produced by Bacillus licheniformis Ali5 in enhanced oil recovery and motor oil removal from contaminated sand. Molecules. 2019;24:4448. doi: 10.3390/molecules24244448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Xu W., Wang H., Lv Z., Shi Y., Wang Z. Antifungal activity and functional components of cell-free supernatant from Bacillus amyloliquefaciens LZN01 inhibit Fusarium oxysporum f. sp. niveum growth. Biotechnol. Biotechnol. Equip. 2019;33:1042–1052. doi: 10.1080/13102818.2019.1637279. [DOI] [Google Scholar]
- 54.Wang Y., Sun Y., Zhang Y., Zhang X., Feng J. Antifungal activity and biochemical response of cuminic acid against Phytophthora capsici Leonian. Molecules. 2016;21:756. doi: 10.3390/molecules21060756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Gao Z., Zhang B., Liu H., Han J., Zhang Y. Identification of endophytic Bacillus velezensis ZSY-1 strain and antifungal activity of its volatile compounds against Alternaria solani and Botrytis cinerea. Biol. Control. 2017;105:27–39. doi: 10.1016/j.biocontrol.2016.11.007. [DOI] [Google Scholar]
- 56.Gong A.D., Li H.P., Yuan Q.S., Song X.S., Yao W., He W.J., Zhang J.B., Liao Y.C. Antagonistic mechanism of iturin A and plipastatin A from Bacillus amyloliquefaciens S76-3 from wheat spikes against Fusarium graminearum. PLoS ONE. 2015;10:e0116871. doi: 10.1371/journal.pone.0116871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Azizullah, Noman M., Gao Y., Wang H., Xiong X., Wang J., Li D., Song F. The SUMOylation pathway components are required for vegetative growth, asexual development, cytotoxic responses, and programmed cell death events in Fusarium oxysporum f. sp. niveum. J. Fungi. 2023;9:94. doi: 10.3390/jof9010094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Noman M., Ahmed T., Ijaz U., Shahid M., Nazir M.M., Azizullah, White J.C., Li D., Song F. Bio-functionalized manganese nanoparticles suppress Fusarium wilt in watermelon (Citrullus lanatus L.) by infection disruption, host defense response potentiation, and soil microbial community modulation. Small. 2023;19:e2205687. doi: 10.1002/smll.202205687. [DOI] [PubMed] [Google Scholar]
- 59.Kampfer P. Limits and possibilities of total fatty acid analysis for classification and identification of Bacillus species. Syst. Appl. Microbiol. 1994;17:86–98. doi: 10.1016/S0723-2020(11)80035-4. [DOI] [Google Scholar]
- 60.Alamer I.S.A., Tomah A.A., Li B., Zhang J.-Z. Isolation, identification and characterization of rhizobacteria strains for biological control of bacterial wilt (Ralstonia solanacearum) of eggplant in China. Agriculture. 2020;10:37. doi: 10.3390/agriculture10020037. [DOI] [Google Scholar]
- 61.Gu Q., Yang Y., Yuan Q., Shi G., Wu L., Lou Z., Huo R., Wu H., Borriss R., Gao X. Bacillomycin D produced by Bacillus amyloliquefaciens is involved in the antagonistic interaction with the plant pathogenic fungus Fusarium graminearum. Appl. Environ. Microbiol. 2017;83:e01075-17. doi: 10.1128/AEM.01075-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Zhao P.C., Quan C.S., Wang Y.G., Wang J.H., Fan S.D. Bacillus amyloliquefaciens Q-426 as a potential biocontrol agent against Fusarium oxysporum f. sp. spinaciae. J. Basic Microbiol. 2014;54:448–456. doi: 10.1002/jobm.201200414. [DOI] [PubMed] [Google Scholar]
- 63.Alabouvette C., Olivain C., Migheli Q., Steinberg C. Microbiological control of soil-borne phytopathogenic fungi with special emphasis on wilt-inducing Fusarium oxysporum. New Phytol. 2009;184:529–544. doi: 10.1111/j.1469-8137.2009.03014.x. [DOI] [PubMed] [Google Scholar]
- 64.Ajilogba C.F., Babalola O.O. Integrated management strategies for tomato Fusarium wilt. Biocontrol Sci. 2013;18:117–127. doi: 10.4265/bio.18.117. [DOI] [PubMed] [Google Scholar]
- 65.Bubici G., Kaushal M., Prigigallo M.I., Gómez-Lama Cabanás C., Mercado-Blanco J. Biological control agents against Fusarium wilt of banana. Front. Microbiol. 2019;10:616. doi: 10.3389/fmicb.2019.00616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zhang X., Xue C., Fang D., He X., Wei M., Zhuo C., Jin J., Shen B., Li R., Ling N., et al. Manipulating the soil microbiomes during a community recovery process with plant beneficial species for the suppression of Fusarium wilt of watermelon. AMB Express. 2021;11:87. doi: 10.1186/s13568-021-01225-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Raza W., Yuan J., Ling N., Huang Q.W., Shen Q.R. Production of volatile organic compounds by an antagonistic strain Paenibacillus polymyxa WR-2 in the presence of root exudates and organic fertilizer and their antifungal activity against Fusarium oxysporum f. sp. niveum. Biol. Control. 2015;80:89–95. doi: 10.1016/j.biocontrol.2014.09.004. [DOI] [Google Scholar]
- 68.Faheem M., Raza W., Zhong W., Nan Z., Shen Q., Xu Y. Evaluation of the biocontrol potential of Streptomyces goshikiensis YCXU against Fusarium oxysporum f. sp. niveum. Biol. Control. 2015;81:101–110. doi: 10.1016/j.biocontrol.2014.11.012. [DOI] [Google Scholar]
- 69.Meyer S.L., Everts K.L., Gardener B.M., Masler E.P., Abdelnabby H.M.E., Skantar A.M. Assessment of DAPG-producing Pseudomonas fluorescens for management of Meloidogyne incognita and Fusarium oxysporum on watermelon. J. Nematol. 2016;48:43–53. doi: 10.21307/jofnem-2017-008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Ge B., Liu B., Nwet T.T., Zhao W., Shi L., Zhang K. Bacillus methylotrophicus strain NKG-1, isolated from Changbai Mountain, China, has potential applications as a biofertilizer or biocontrol agent. PLoS ONE. 2016;11:e0166079. doi: 10.1371/journal.pone.0166079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Xu W., Wang K., Wang H., Liu Z., Shi Y., Gao Z., Wang Z. Evaluation of the biocontrol potential of Bacillus sp. WB against Fusarium oxysporum f. sp. niveum. Biol. Control. 2020;147:104288. doi: 10.1016/j.biocontrol.2020.104288. [DOI] [Google Scholar]
- 72.Wang H., Wang Z., Liu Z., Wang K., Xu W. Membrane disruption of Fusarium oxysporum f. sp. niveum induced by myriocin from Bacillus amyloliquefaciens LZN01. Microb. Biotechnol. 2021;14:517–534. doi: 10.1111/1751-7915.13659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Wu Y., Zhou J., Li C., Ma Y. Antifungal and plant growth promotion activity of volatile organic compounds produced by Bacillus amyloliquefaciens. Microbiologyopen. 2019;8:e00813. doi: 10.1002/mbo3.813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Zhu J., Tan T., Shen A., Yang X., Yu Y., Gao C., Li Z., Cheng Y., Chen J., Guo L., et al. Biocontrol potential of Bacillus subtilis IBFCBF-4 against Fusarium wilt of watermelon. J. Plant Pathol. 2020;102:433–441. doi: 10.1007/s42161-019-00457-6. [DOI] [Google Scholar]
- 75.Grubbs K.J., Bleich R.M., Santa Maria K.C., Allen S.E., Farag S., Shank E.A., Bowers A.A. Large-scale bioinformatics analysis of Bacillus genomes uncovers conserved roles of natural products in bacterial physiology. mSystems. 2017;2:e00040-17. doi: 10.1128/mSystems.00040-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Kiesewalter H.T., Lozano-Andrade C.N., Wibowo M., Strube M.L., Maróti G., Snyder D., Jørgensen T.S., Larsen T.O., Cooper V.S., Weber T., et al. Genomic and chemical diversity of Bacillus subtilis secondary metabolites against plant pathogenic fungi. mSystems. 2021;6:e00770-20. doi: 10.1128/mSystems.00770-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Dunlap C.A., Bowman M.J., Rooney A.P. Iturinic lipopeptide diversity in the Bacillus subtilis species group—Important antifungals for plant disease biocontrol applications. Front. Microbiol. 2019;10:1794. doi: 10.3389/fmicb.2019.01794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Deepak R., Jayapradha R. Lipopeptide biosurfactant from Bacillus thuringiensis pak2310: A potential antagonist against Fusarium oxysporum. J. Mycol. Med. 2015;25:e15–e24. doi: 10.1016/j.mycmed.2014.10.011. [DOI] [PubMed] [Google Scholar]
- 79.Nayarisseri A., Singh P., Singh S. Screening, isolation and characterization of biosurfactant producing Bacillus subtilis strain ANSKLAB03. Bioinformation. 2018;14:304–314. doi: 10.6026/97320630014304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Ji S.H., Paul N.C., Deng J.X., Kim Y.S., Yun B.S., Yu S.H. Biocontrol activity of Bacillus amyloliquefaciens CNU114001 against fungal plant diseases. Mycobiology. 2013;41:234–242. doi: 10.5941/MYCO.2013.41.4.234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Hazarika D.J., Goswami G., Gautom T., Parveen A., Das P., Barooah M., Boro R.C. Lipopeptide mediated biocontrol activity of endophytic Bacillus subtilis against fungal phytopathogens. BMC Microbiol. 2019;19:71. doi: 10.1186/s12866-019-1440-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Luo S., Wang H., Wang Z., Xu W., Tian R., Zhou J. Internalization of myriocin involved in energy and affected expression of genes and proteins in the endocytosis pathway in Fusarium oxysporum f. sp. niveum. Biotechnol. Biotechnol. Equip. 2022;36:520–532. doi: 10.1080/13102818.2022.2100721. [DOI] [Google Scholar]
- 83.Wang H., Wang Z., Xu W., Wang K. Comprehensive transcriptomic and proteomic analyses identify intracellular targets for myriocin to induce Fusarium oxysporum f. sp. niveum cell death. Microb. Cell Fact. 2021;20:69. doi: 10.1186/s12934-021-01560-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Du J., Ji Y., Li Y., Liu B., Yu Y., Chen D., Li Z., Zhao T., Xu X., Chang Q., et al. Microbial volatile organic compounds 2-heptanol and acetoin control Fusarium crown and root rot of tomato. J. Cell Physiol. 2022 doi: 10.1002/jcp.30889. [DOI] [PubMed] [Google Scholar]
- 85.Tahir H.A., Gu Q., Wu H., Raza W., Hanif A., Wu L., Colman M.V., Gao X. Plant growth promotion by volatile organic compounds produced by Bacillus subtilis SYST2. Front. Microbiol. 2017;8:171. doi: 10.3389/fmicb.2017.00171. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the data are present inside the manuscript file.








