Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rat anti-mouse Ly6G FITC (1A8) | BioLegend | Cat# 127606 | Flow (1:100) |
| Antibody | Rat anti-mouse MHC-II FITC (M5/114.15.2) | BioLegend | Cat# 107606 | Flow (1:400) |
| Antibody | Rat anti-mouse Ly6C PerCP-Cy5.5 (HK1.4) | BioLegend | Cat# 128012 | Flow (1:200) |
| Antibody | Rat anti-mouse Ly6C Brilliant Violet 605 (HK1.4) | BioLegend | Cat# 128036 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11b PE-Cy7 (M1/70) | BioLegend | Cat# 101216 | Flow (1:400) |
| Antibody | Rat anti-mouse CD11b APC (M1/70) | BioLegend | Cat# 101212 | Flow (1:400) |
| Antibody | Rat anti-mouse CD115 PE (AFS98) | BioLegend | Cat# 135506 | Flow (1:100) |
| Antibody | Rat anti-mouse CD115 APC (AFS98) | BioLegend | Cat# 135510 | Flow (1:100) |
| Antibody | Rat anti-mouse B220 Brilliant Violet 605 (RA3-6B2) | BioLegend | Cat# 103244 | Flow (1:400) |
| Antibody | Rat anti-mouse B220 FITC (RA3-6B2) | BD Biosciences | Cat# 553087 | Flow (1:400) |
| Antibody | Hamster anti-mouse CD3e Brilliant Violet 711 (145-2C11) | BioLegend | Cat# 100349 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD3e FITC (145-2C11) | BD Biosciences | Cat# 553062 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11a APC (M17/4) | BioLegend | Cat# 101120 | Flow (1:100) |
| Antibody | Rat anti-mouse CD117 PE-Cy7 (2B8) | BioLegend | Cat# 105814 | Flow (1:100) |
| Antibody | Rat anti-mouse CD11b PerCP-Cy5.5 (M1/70) | BioLegend | Cat# 101228 | Flow (1:400) |
| Antibody | Rat anti-mouse CD135 Brilliant Violet 421 (A2F10.1) | BioLegend | Cat# 135315 | Flow (1:100) |
| Antibody | Rat anti-mouse Sca1 Brilliant Violet 711 (D7) | BioLegend | Cat# 108131 | Flow (1:100) |
| Antibody | Rat anti-mouse CD16/CD32 APC-Cy7 (93) | BioLegend | Cat# 101328 | Flow (1:100) |
| Antibody | Rat anti-mouse CD135 APC (A2F10.1) | BioLegend | Cat# 135310 | Flow (1:100) |
| Antibody | Rat anti-mouse CD49b FITC (DX5) | BD Biosciences | Cat# 553857 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD11c APC (HL3) | BD Biosciences | Cat# 550261 | Flow (1:100) |
| Antibody | Anti-mouse CD45 APC-eFluor 780 (30-F11) | eBioscience | Cat# 47-0451-82 | Flow (1:100) |
| Antibody | Rat anti-mouse Ly6G Brilliant Violet 421 (1A8) | BioLegend | Cat# 127628 | Flow (1:100) |
| Antibody | Rat anti-mouse F4/80 Brilliant Violet 785 (BM8) | BioLegend | Cat# 123141 | Flow (1:400) |
| Antibody | Rat anti-mouse F4/80 Alexa Fluor 488 (BM8) | BioLegend | Cat# 123120 | IF (1:200) |
| Antibody | Rat anti-mouse MHC-II PerCP eFluor710 (M5/114.15.2) | eBioscience | Cat# 46-5321-82 | Flow (1:400) |
| Antibody | Rat anti-mouse Sca1 PE-Dazzle 594 (D7) | BioLegend | Cat# 108138 | Flow (1:100) |
| Antibody | Rat anti-mouse CD43 Alexa Fluor 700 (S11) | BioLegend | Cat# 143214 | Flow (1:400) |
| Antibody | Rat anti-mouse CD43 | BioLegend | Cat# 143202 | IF (1:50) |
| Antibody | Goat anti-Art IgG (H+L) Cross-Adsorbed secondary antibody, Alexa-Fluor 555 | Thermo Fisher | Cat# A-21434 | IF (1:400) |
| Antibody | Rat anti-mouse CXCR4 Alexa Fluor 647 (L276F12) | BioLegend | Cat# 146504 | Flow (1:100) |
| Antibody | Rat anti-mouse CCR2 Brilliant Violet 510 (SA203G11) | BioLegend | Cat# 150617 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD11c PE-Cy7 (HL3) | BD Biosciences | Cat# 561022 | Flow (1:100) |
| Antibody | Rat anti-mouse Ly6C eFluor450 (HK1.4) | eBioscience | Cat# 48-5932-82 | Flow (1:100) |
| Antibody | Rat anti-mouse CD68 Alexa Fluor 488 (FA-11) | BioLegend | Cat# 137012 | IF (1:100) |
| Antibody | Rat anti-mouse Ly6G eFluor450 (1A8) | eBioscience | Cat# 48-9668-82 | Flow (1:100) |
| Antibody | Rat anti-mouse B220 PE-Cy5 (RA3-6B2) | BioLegend | Cat# 103210 | Flow (1:400) |
| Antibody | Rat anti-mouse CD4 PE-Cy5 (RM4-5) | BioLegend | Cat# 100513 | Flow (1:100) |
| Antibody | Rat anti-mouse CD5 PE-Cy5 (53-7.3) | BioLegend | Cat# 100604 | Flow (1:100) |
| Antibody | Rat anti-mouse CD8 PE-Cy5 (53-6.7) | BioLegend | Cat# 100710 | Flow (1:100) |
| Antibody | Rat anti-mouse TER119 PE-Cy5 (TER119) | BioLegend | Cat# 116210 | Flow (1:100) |
| Antibody | Rat anti-mouse GR1 PE-Cy5 (RB6-8C5) | BioLegend | Cat# 108410 | Flow (1:100) |
| Antibody | Rat anti-mouse CD150 PE-Cy7 (TC15-12F12.2) | BioLegend | Cat# 115914 | Flow (1:100) |
| Antibody | Rat anti-mouse CD117 APC eFluro780 (2B8) | eBioscience | Cat# 47-1171-82 | Flow (1:100) |
| Antibody | Rat anti-mouse Sca1 BV785 (D7) | BioLegend | Cat# 108139 | Flow (1:100) |
| Antibody | Hamster anti-mouse CD48 APC (HM48-1) | BioLegend | Cat# 103412 | Flow (1:100) |
| Antibody | Anti-mouse Ly6G (1A8, mouse chimeric) | Absolute Antibody | Cat# Ab00295-2.3 | Flow (1:100) |
| Antibody | Anti-mouse GR1 (RB6-8C5, mouse chimeric) | Absolute Antibody | Cat# Ab01030-2.0 | Flow (1:100) |
| Antibody | Rat anti-mouse IL-6R (15A7) | BioXcell | Cat# BE0047 | |
| Antibody | Rat IgG2b isotype control, anti-keyhole limpet hemocyanin (LTF-2) | BioXcell | Cat# BE0090 | |
| Peptide, , recombinant protein | R848 (water soluble) | Invivogen | tlrl-r848 | |
| Peptide, , recombinant protein | R848 | Enzo | ALX-420-038M025 | |
| Peptide, , recombinant protein | Poly(I:C) (LMW) | Invivogen | tlrl-picw | |
| Peptide, , recombinant protein | CpG (ODN 2395) | Invivogen | tlrl-2395 | |
| Peptide, , recombinant protein | LPS (E. coli 055:B5) | Invivogen | tlrl-b5lps | |
| Chemical compound, drug | Aldara (Imiquimod) | Meda Pharmaceuticals | 5% cream | |
| Chemical compound, drug | Anakinra | Swedish Orphan Biovitrum | 150 mg/ml | |
| Chemical compound, drug | Etanercept (Enbrel) | Pfizer Europe | 25 mg | |
| Chemical compound, drug | Baytril | Bayer Corporation | ||
| Chemical compound, drug | Tamoxifen | Sigma | Cat# T5648-1G | |
| Chemical compound, drug | Phorbol 12-myristate 13-acetate (TPA) | Sigma-Aldrich | Cat# P8139 | |
| Chemical compound, drug | Tetramethylrhodamine isothiocyanate–Dextran, 70 kDa | Sigma-Aldrich | Cat# T11-62 | |
| Chemical compound, drug | Bromodeoxyuridine (BrDU) | BioLegend | Cat# 423401 | |
| Chemical compound, drug | Liberase TM Research grade | Roche | Cat# 5401119001 | |
| Chemical compound, drug | DNase I (grade II) from bovine pancreas | Sigma-Aldrich | Cat# 10104159001 | |
| Commercial assay or kit | RNA-Later | Thermo Fisher | Cat# AM7020 | |
| Commercial assay or kit | LIVE/DEAD Fixable Aqua Dead Cell Stain Kit | Life Technologies | Cat# L34597 | |
| Commercial assay or kit | BD FACS Lysis Solution 10X Concentrate | BD Biosciences | Cat# 349202 | |
| Commercial assay or kit | RNEasy Mini Kit | QIAGEN | Cat# 74104 | |
| Commercial assay or kit | RNEasy Micro Plus Kit | QIAGEN | Cat# 74034 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | Bio-Rad | Cat# 1708891 | |
| Commercial assay or kit | QuantiTect Probe PCR Kit | QIAGEN | Cat# 204343 | |
| Commercial assay or kit | High-Capacity RNA-to-cDNA kit | Applied Biosystems | Cat# 4387406 | |
| Commercial assay or kit | Legendplex Mix and Match Kit | BioLegend | ||
| Commercial assay or kit | BrdU Staining Kit | eBioscience | Cat# 8817-6600 | |
| Strain, strain background (Mus musculus, C57BL/6) | B6.129P-Cx3cr1tm1Litt/J | Jackson Laboratory | JAX stock #005582 | Jung et al., 2000 |
| Strain, strain background (M. musculus, C57BL/6) | B6(Cg)-Ifnar1tm1.2Ees/J | Jackson Laboratory | JAX stock #028288 | Hwang et al., 1995 |
| Strain, strain background (M. musculus, C57BL/6) | B6(Cg)-Rag2tm1.1Cgn/J | Jackson Laboratory | JAX stock #08449 | Hao and Rajewsky, 2001 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129P2-Lyz2tm1(cre)Ifo/J | Jackson Laboratory | JAX stock #004781 | Clausen et al., 1999 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129(Cg)-Ccr2tm2.1Ifc/J | Jackson Laboratory | JAX stock #017586 | Saederup et al., 2010 |
| Strain, strain background (M. musculus, C57BL/6) | B6.129P2-Tlr7tm1Aki | Hemmi et al., 2002 | ||
| Strain, strain background (M. musculus, C57BL/6) | B6.129S7-Ifngtm1Ts/J | Jackson Laboratory | JAX stock #002287 | Dalton et al., 1993 |
| Strain, strain background (M. musculus; C57BL/6) | Tlr7flox/flox | Solmaz et al., 2019 | ||
| Strain, strain background (M. musculus; BALB/c) | Cpa3- cre4Glli | Jackson Laboratory | JAX stock #026828 | Feyerabend et al., 2011 |
| Strain, strain background (M. musculus; BALB/c) | Gata1tm6Sho/J | Jackson Laboratory | JAX stock #05653 | Yu et al., 2002 |
| Strain, strain background (M. musculus; C57BL/6) | HSC-SCL-Cre-ERT;R26R-EYFP | Göthert et al., 2005 | ||
| Strain, strain background (influenza A virus) |
strain X31 | John McCauley | Davidson, S., 2014 |
|
| Strain, strain background (RSV) | Strain A2 | ATCC | ATCC VR-1540 | |
| Sequence-based reagent | RSV L gene forward | Invitrogen | GAACTCAGT GTA GGT AGAATGTTTGCA | |
| Sequence-based reagent | RSV L gene reverse | Invitrogen | TTCAGCTATCATTTTCTCTGCCAAT | |
| Sequence-based reagent | RSV L FAM-TAMRA probe | Eurofins MWG Operon | TTTGAACCTGTCTGAACATTCCCGGTT | |
| Sequence-based reagent | Flu M1 gene forward | Invitrogen | AAGACCAATCCTGTCACCTCTGA | |
| Sequence-based reagent | Flu M1 gene reverse | Invitrogen | CAAAGCGTCTACGCTGCA | |
| Sequence-based reagent | Flu M1 FAM-TAMRA probe | Eurofins MWG Operon | TTTGTGTTCACGCTCACCGT | |
| Software, algorithm | GraphPad Software (Prism) | GraphPad Software, Inc, La Jolla, California, USA | Version 9 | |
| Software, algorithm | FlowJo | Tree Star Inc Ashland, OR, USA | Version 10.7.1 | |
| Software, algorithm | Imaris 8.0.1 | Bitplane AG | ||
| Software, algorithm | FIJI | ImageJ2 (open source) | ||
| Software, algorithm | 7500 Fast System SDS v1.4 21 CFR Part 11 Module | Applied Biosystems | ||
| Software, algorithm | QuantStudio Software V1.2.4 | Applied Biosystems |