| Antibodies |
| Rabbit polyclonal anti-SLFN5 |
Novus Biologicals |
Cat#NBP1-81178; RRID:AB_11003398 |
| Rabbit polyclonal anti-53BP1 |
Novus Biologicals |
Cat#NB100-304; RRID:AB_10003037 |
| Mouse monoclonal anti-BRCA1 |
Santa Cruz |
Cat#sc-6954; RRID:AB_626761 |
| Mouse monoclonal anti-BRCA1 |
GeneTex |
Cat#GTX70111; RRID:AB_368627 |
| Mouse monoclonal anti-phospho-Histone H2A.X (Ser139) |
Millipore |
Cat#05-636; RRID:AB_309864 |
| Rabbit polyclonal anti-RIF1 |
Bethyl Laboratories |
Cat#A300-569A; RRID:AB_669804 |
| Rabbit polyclonal anti-PTIP |
Thermo Fisher Scientific |
Cat#A300-370A; RRID:AB_2160127 |
| Mouse monoclonal anti- REV7/MAD2L2 |
Santa Cruz |
Cat#sc-135977; RRID:AB_2139534 |
| Rabbit polyclonal anti-SHLD3 |
Novus Biologicals |
Cat#NBP2-49564 |
| Mouse monoclonal anti-CtIP |
Active Motif |
Cat#61141; RRID:AB_2714164 |
| Goat polyclonal anti-MCM2 |
Bethyl Laboratories |
Cat#A300-122A; RRID:AB_155897 |
| Rabbit polyclonal anti-RAD51 |
GeneTex |
Cat#GTX100469; RRID:AB_1951602 |
| Rabbit polyclonal anti-RAD51 |
Abcam |
Cat#ab176458; RRID:AB_2665405 |
| Mouse monoclonal anti-RPA2 |
Santa Cruz |
Cat#sc-56770; RRID:AB_785534 |
| Rabbit polyclonal anti-SUN1 |
Sigma-Aldrich |
Cat#HPA008346; RRID:AB_1080462 |
| Rabbit polyclonal anti-SUN2 |
Sigma-Aldrich |
Cat#HPA001209; RRID:AB_1080465 |
| Rabbit monoclonal anti-phospho--Chk2 (Thr68) |
Cell Signaling |
Cat#2197; RRID:AB_2080501 |
| Rabbit polyclonal anti-mouse TRF1(#1449) |
Gift from Dr. Titia de Lange; Lottersberger et al.15
|
N/A |
| Mouse monoclonal anti-FLAG |
Sigma-Aldrich |
Cat#F1804; RRID:AB_262044 |
| Mouse monoclonal anti-HA |
Sigma-Aldrich |
Cat#H9658; RRID:AB_260092 |
| Mouse monoclonal anti-GFP |
Santa Cruz |
Cat#sc-9996; RRID:AB_627695 |
| Mouse monoclonal anti-β-Actin |
Sigma-Aldrich |
Cat#A2228; RRID:AB_476697 |
| Mouse monoclonal anti-α-Tubulin |
Sigma-Aldrich |
Cat#T5168; RRID:AB_477579 |
| Mouse monoclonal anti-GAPDH |
Proteintech |
Cat#60004-1-Ig; RRID:AB_2107436 |
| Rabbit IgG (ChIP grade) |
Abcam |
Cat#ab171870; RRID:AB_2687657 |
| Normal rabbit IgG |
Millipore |
Cat#12-370; RRID:AB_145841 |
| APC mouse anti-phospho-Histone H2A.X (Ser139) |
BioLegend |
Cat#613416; RRID:AB_2629534 |
| APC rat anti-mouse CD71 |
BioLegend |
Cat#113820; RRID:AB_2728135 |
| FITC rat anti-mouse CD19 |
BD Biosciences |
Cat#557398; RRID:AB_396681 |
| APC rat anti-mouse CD19 |
BD Biosciences |
Cat#550992; RRID:AB_398483 |
| APC rat anti-mouse B220 |
BioLegend |
Cat#103212; RRID:AB_312997; |
| PE rat anti-mouse IgG1 |
BD Biosciences |
Cat#562027; RRID:AB_10894761 |
| PE rat anti-mouse IgG2b |
BioLegend |
Cat#406708; RRID:AB_2563381 |
| PE rat anti-mouse IgE |
BioLegend |
Cat#406907; RRID:AB_493291 |
| Rat anti-mouse IgG3 |
BD Biosciences |
Cat#553401; RRID:AB_394838 |
| FITC rat anti-mouse CD45 |
BioLegend |
Cat#103108; RRID:AB_312973 |
| APC rat anti-mouse CD4 |
BD Biosciences |
Cat#553051; RRID:AB_398528 |
| PE rat anti-mouse CD4 |
BioLegend |
Cat#100512; RRID:AB_312715 |
| APC rat anti-mouse CD8a |
BioLegend |
Cat#100712; RRID:AB_312751 |
| AP-conjugated goat anti-mouse IgM |
SouthernBiotech |
Cat#1020-04; RRID:AB_2794200 |
| AP-conjugated goat anti-mouse IgG1 |
SouthernBiotech |
Cat#1070-04; RRID:AB_2794411 |
| Alexa Fluor 488-labeled goat anti-mouse IgG (H+L) |
Jackson ImmunoResearch |
Cat#115-545-062; RRID:AB_2338845 |
| Alexa Fluor 488-labeled goat anti-rabbit IgG (H+L) |
Jackson ImmunoResearch |
Cat#111-545-045; RRID:AB_2338049 |
| Alexa Fluor 488- labeled donkey anti-rabbit IgG (H+L) |
Jackson ImmunoResearch |
Cat#711-545-152; RRID:AB_2313584 |
| Rhodamine Red-X-labeled goat anti-mouse IgG (H+L) |
Jackson ImmunoResearch |
Cat#115-295-146; RRID:AB_2338766 |
| Rhodamine Red-X-labeled goat anti-rabbit IgG (H+L) |
Jackson ImmunoResearch |
Cat#111-295-144; RRID:AB_2338028 |
| Alexa Fluor 647-labeled donkey anti-goat IgG (H+L) |
Jackson ImmunoResearch |
Cat#705-605-147; RRID:AB_2340437 |
| HRP goat anti-mouse IgG (H+L) |
Jackson ImmunoResearch |
Cat#115-035-146; RRID:AB_2307392 |
| HRP goat anti-rabbit IgG (H+L) |
Jackson ImmunoResearch |
Cat#111-035-144; RRID:AB_2307391 |
| Bacterial and virus strains |
| Bacteria: DH5α competent cells |
NEB |
Cat#C2987H |
| Bacteria: BL21(DE3) competent cells |
Thermo Fisher Scientific |
Cat#EC0114 |
| Chemicals, peptides, and recombinant proteins |
| (Z)-4-Hydroxytamoxifen (4-OHT) |
Sigma-Aldrich |
Cat#H7904 |
| Shield-1 ligand |
AOBIOUS |
Cat#AOB1848 |
| TransIT-X2 |
Mirus |
Cat#MIR6006 |
| Anti-FLAG M2 Affinity Gel |
Sigma-Aldrich |
Cat#A2220 |
| Anti-HA Affinity Gel |
Sigma-Aldrich |
Cat#E6779 |
| 3× Flag peptide |
Sigma-Aldrich |
Cat#F4799 |
| Protein A/G Magnetic Beads |
Thermo Fisher Scientific |
Cat#88803 |
| Gel Filtration Standard |
Bio-Rad |
Cat#1511901 |
| Isopropyl β-D-1-thiogalactopyranoside (IPTG) |
Thermo Fisher Scientific |
Cat#15529019 |
| Protease Inhibitor Cocktail |
Roche |
Cat#4693159001 |
| Glutathione Sepharose 4B |
Millipore |
Cat#GE17-0756-01 |
| Olaparib (AZD2281) |
LC labs |
Cat#O-9201 |
| Cisplatin |
MedChemExpress |
Cat#HY-17394 |
| ATM kinase inhibitor KU55933 |
Abcam |
Cat#ab120637 |
| Latrunculin B (Lat B) |
Sigma-Aldrich |
Cat#L5288 |
| CK-666 |
Sigma-Aldrich |
Cat#SML0006 |
| Nocodazole (Noco) |
Sigma-Aldrich |
Cat#M1404 |
| Paclitaxel (Taxol) |
Sigma-Aldrich |
Cat#T7402 |
| CCK-8 solution |
MesGen Biotech |
Cat#MG6432 |
| Giemsa solution |
Sigma-Aldrich |
Cat#GS500 |
| Colcemid |
Thermo Fisher Scientific |
Cat#15210040 |
| Heparin |
Calbiochem |
Cat#375095 |
| PerfectHyb Plus hybridization buffer |
Sigma-Aldrich |
Cat#H7033 |
| Red blood cell lysis buffer |
Sigma-Aldrich |
Cat#R7757 |
| LPS |
Sigma-Aldrich |
Cat#L7770 |
| IL4 |
R&D Systems |
Cat#404-ML-050 |
| NP-BSA |
Biosearch Technologies |
Cat#5050H |
| NP-CGG |
Biosearch Technologies |
Cat#5055C |
| Imject Alum adjuvant |
Thermo Fisher Scientific |
Cat#77161 |
| PI/RNase Staining Solution |
Thermo Fisher Scientific |
Cat#F10797
|
| DAPI |
Thermo Fisher Scientific |
Cat#D1306 |
| SYBR Gold |
Thermo Fisher Scientific |
Cat#S11494 |
| Streptavidin PE Conjugate |
Thermo Fisher Scientific |
Cat#12-4317-87 |
| Phosphatase substrate |
Sigma-Aldrich |
Cat#P4744 |
| Critical commercial assays |
| Telomere PNA FISH Kit/Cy3 |
Agilent |
Cat#K532611-8 |
| QuikChange Site-Directed Mutagenesis Kit |
Agilent |
Cat#200518 |
| Duo-link in situ PLA Kit |
Sigma-Aldrich |
Cat#DUO92101 |
| Biotin Chromogenic Detection Kit |
Thermo Fisher Scientific |
Cat#K0661 |
| ATPase/GTPase Activity Assay Kit |
Sigma-Aldrich |
Cat#MAK113 |
| Single-Cell Gel Electrophoresis Assay Kit |
R&D Systems |
Cat#4250-050-K |
| Simple ChIP Enzymatic Chromatin IP Kit |
Cell Signaling |
Cat#9004 |
| PerfectStart Green qPCR SuperMix |
TransGen Biotech |
Cat#AQ601-01 |
| Mouse Immunoglobulin Isotyping Kit |
BioLegend |
Cat#740492 |
| EasySep Mouse B Cell Isolation Kit |
Stemcell Tech |
Cat#19854 |
| Deposited data |
| Mendeley dataset |
This paper |
http://dx.doi.org/10.17632/9n4g54vcdh.1
|
| Experimental models: Cell lines |
| Human: HEK293T |
ATCC |
Cat#CRL-11268; RRID:CVCL_1926 |
| Human: Phoenix-AMPHO |
ATCC |
Cat#CRL-3213; RRID:CVCL_H716 |
| Human: U2OS |
ATCC |
Cat#HTB-96; RRID:CVCL_0042 |
| Human: HeLa-53BP1 KO |
Gift from Dr. Junjie Chen |
N/A |
| Human: 293A-53BP1 KO |
Gift from Dr. Junjie Chen |
N/A |
| Human: ER-mCherry-LacI-FokI-DD U2OS |
Gift from Dr. Roger A. Greenberg; Tang et al.42
|
N/A |
| Human: U2OS-BRCA1 KO |
Zhao et al.21
|
N/A |
| Human: U2OS-BRCA1/53BP1 double KO |
Zhao et al.21
|
N/A |
| MEF: Trf2F/−; CreERT2
|
ATCC |
Cat#CRL-3317; RRID:CVCL_UE13 |
| MEF: Trf2F/−
Slfn5−/−; CreERT2
|
This paper |
N/A |
| MEF: Slfn5+/+
|
This paper |
N/A |
| MEF: Slfn5−/−
|
This paper |
N/A |
| Experimental models: Organisms/strains |
| Mouse: Slfn5+/+. C57BL/6J |
This paper |
N/A |
| Mouse: Slfn5−/−. C57BL/6J |
This paper |
N/A |
| Oligonucleotides |
| Primer for genotyping Slfn5 allele: Forward#1, 5’-TTTACAGATGACCCGAGAGACTTT-3’; |
This paper |
N/A |
| Primer for genotyping Slfn5 allele: Forward#2, 5’-CTATGATTTCAGGGTGAGTCCAG-3’ |
This paper |
N/A |
| Primer for genotyping Slfn5 allele: Reverse, 5’-AGTTTCAGAGAAGCCGAGCGTGG-3’ |
This paper |
N/A |
| Telomeric probe: Biotin-100 bp of repeated TTAGGG |
This paper |
N/A |
| B1 probe: Biotin-TAATCCCAGCACTTGGGAGGC |
This paper |
N/A |
| Primer for U2OS-DSB-reporter locus qPCR: P1: Forward, 5’-GGAAGATGTCCCTTGTATCACCAT-3’ |
Tang et al.42
|
N/A |
| Primer for U2OS-DSB-reporter locus qPCR: P1: Reverse, 5’-TGGTTGTCAACAGAGTAGAAAGTGAA-3’ |
Tang et al.42
|
N/A |
| Primer for U2OS-DSB-reporter locus qPCR: P3: Forward, 5’-GGCATTTCAGTCAGTTGCTCAA-3’ |
Tang et al.42
|
N/A |
| Primer for U2OS-DSB-reporter locus qPCR: P3: Reverse, 5’-TTGGCCGATTCATTAATGCA-3’ |
Tang et al.42
|
N/A |
| Primer for Sμ region: Forward, 5’-GCTAAACTGAGGTGATTACTCTGAGGTAAG-3’ |
Zan et al.60
|
N/A |
| Primer for Sμ region: Reverse, 5’-GTTTAGCTTAGCGGCCCAGCTCATTCCAGT-3’ |
Zan et al.60
|
N/A |
| Primer for Sγ1 region: Forward, 5’-ATAAGTAGTAGTTGGGGATTC-3’ |
Zan et al.60
|
N/A |
| Primer for Sγ1 region: Reverse, 5’-CTCAGCCTGGTACCTTATACA-3’ |
Zan et al.60
|
N/A |
| Primer for Sγ3 region: Forward, 5’-AATCTACAGAGAGCCAGGTGG-3’ |
Zan et al.60
|
N/A |
| Primer for Sγ3 region: Reverse, 5’-TGGTTTTCCATGTTCCCACTT-3’ |
Zan et al.60
|
N/A |
| Recombinant DNA |
| pLVX3-FLAG-SLFN5 |
This paper |
N/A |
| pLVX3-FLAG-SLFN5 (E191A/E196A) |
This paper |
N/A |
| pLVX3-FLAG-SLFN5 (K584M) |
This paper |
N/A |
| pLVX3-FLAG-SLFN5 (D649A) |
This paper |
N/A |
| pGEX-4T-2-SLFN5 |
This paper |
N/A |
| pGEX-4T-2-SLFN5 (D649A) |
This paper |
N/A |
| pMX-53BP1-DB-FLAG |
Gift from Dr. Titia de Lange; Lottersberger et al.15
|
N/A |
| pMX-53BP1-DB-Δ28-FLAG |
Gift from Dr. Titia de Lange; Lottersberger et al.15
|
N/A |
| pMX-53BP1-DB-ΔPTIP-FLAG |
Gift from Dr. Titia de Lange; Lottersberger et al.15
|
N/A |
| pMX-53BP1-DB-ΔMob-FLAG |
Gift from Dr. Titia de Lange; Lottersberger et al.15
|
N/A |
| pMX-53BP1-DB-ΔPro-FLAG |
Gift from Dr. Michela Di Virgilio; Sundaravinayagam et al.45
|
N/A |
| pMX-53BP1-DB-ΔRIF1-FLAG |
Gift from Dr. Michela Di Virgilio; Sundaravinayagam et al.45
|
N/A |
| pMX-53BP1-DB-ΔCore-FLAG |
Gift from Dr. Michela Di Virgilio; Sundaravinayagam et al.45
|
N/A |
| pMX-53BP1-DB-ΔMob/ΔCore-FLAG |
This paper |
N/A |
| HA-53BP1 |
Gift from Dr. Junjie Chen |
N/A |
| HA-53BP1-Δ(1–1051) |
Gift from Dr. Junjie Chen |
N/A |
| HA-53BP1-Δ(1052–1302) |
Gift from Dr. Junjie Chen |
N/A |
| HA-53BP1-ΔTudor |
Gift from Dr. Junjie Chen |
N/A |
| HA-53BP1-ΔBRCT |
Gift from Dr. Junjie Chen |
N/A |
| pLVX2-HA-53BP1 |
This paper |
N/A |
| pLVX2-HA-53BP1-ΔTudor/ΔBRCT |
This paper |
N/A |
| FLAG-RIF1 |
Gift from Dr. Dongyi Xu |
N/A |
| SFB-REV7 |
Gift from Dr. Jun Huang |
N/A |
| SFB-SHLD3 |
Gift from Dr. Jun Huang |
N/A |
| pLVX3-FLAG-SUN2 |
This paper |
N/A |
| pLVX3-FLAG-SUN2-Δ(1–150) |
This paper |
N/A |
| mCherry-BP1-2 pLPC-Puro |
Addgene |
Cat#19835 |
| shRNA#1 targeting SLFN5
|
Sigma-Aldrich |
Cat#TRCN0000154288 |
| shRNA#2 targeting SLFN5
|
Sigma-Aldrich |
Cat#TRCN0000157669 |
| shRNA#1 targeting 53BP1
|
Sigma-Aldrich |
Cat#TRCN0000218999 |
| shRNA#2 targeting 53BP1
|
Sigma-Aldrich |
Cat#TRCN0000018865 |
| shRNA#1 targeting RIF1
|
Sigma-Aldrich |
Cat#TRCN0000155022 |
| shRNA#2 targeting RIF1
|
Sigma-Aldrich |
Cat#TRCN0000220017 |
| shRNA#1 targeting REV7
|
Sigma-Aldrich |
Cat#TRCN0000006573 |
| shRNA#2 targeting REV7
|
Sigma-Aldrich |
Cat#TRCN0000006570 |
| shRNA targeting SUN1
|
Sigma-Aldrich |
Cat#TRCN0000134596 |
| shRNA targeting SUN2
|
Sigma-Aldrich |
Cat#TRCN0000141514 |
| shRNA#1 targeting Brca1
|
Addgene |
Cat#44594 |
| shRNA#2 targeting Brca1
|
Addgene |
Cat#44595 |
| sgRNA targeting 53bp1
|
Santa Cruz |
Cat#sc-424212- KO-2 |
| pLent-U6-CMV-copGFP-P2A-puro-shRNA targeting 53bp1 (sense: GCTATTGTGGAGATTGTGTTT) |
WZ Biosciences; Xu et al.61
|
N/A |
| lentiCRISPRv2-sgRNA targeting Slfn5 (sense: TTGCCAAAGCGCCCGATTCC) |
Genscript |
N/A |
| Software and algorithms |
| ZEN Blue |
Zeiss |
https://www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite
|
| Fiji |
Open source |
https://imagej.net/software/fiji/
|
| Prism 9 |
GraphPad |
https://www.graphpad.com/
|
| FlowJo 10.1 |
FlowJo LLC |
https://www.flowjo.com/
|
| Matlab R2019b (9.7.0) |
MathWorks |
https://uk.mathworks.com
|
| Python 3.0 |
Python |
https://www.python.org/
|
