Table 1.

List of primers used in the study.

Primer #	Sequence	Purpose
SD1_M	ccgctcggcggcttctaatcgccggtctctagccactgggatcc	Forward primer to amplify the backbone of pYG026 plasmid. Overhang sequence from 5’PGAL1 for Gibson assembly
SD2_M	cagatccgctagggataacagggtaatatgcatgc	Reverse primer to amplify the backbone of pYG026 plasmid.
SD3	ggcgcgccacttctaaataagc	Forward primer to amplify the ADH1 terminator region starting from the 20bps between the stop codon of yeGFP and the start of the terminator
SD4	ccctgttatccctagcggatctg	Reverse primer to amplify the ADH1 terminator region from the region right outside the terminator so the ADH1 insert has some plasmid background sequence for Gibson assembly
SD5	tatactttaacgtcaaggagatgtctaaaggtgaagaattattcactgg	Reverse primer to be used with SD1_M primer to linearize the pYG026 backbone for the purpose of inserting GAL1 promoter upstream of yeGFP. Has overhang sequences from 3’PGAL1
SD6	cgattagaagccgccgagcgg	Forward primer to amplify the GAL1 promoter from the pSD01 vector for Gibson assembly
SD7	ctccttgacgttaaagtatagaggtatattaacaattttttgttg	Reverse primer to amplify the GAL1 promoter from the pSD01 vector for Gibson assembly
SD8	gcttatttagaagtggcgcgccttacacgttaattcttgcgcttgcgcagg	Reverse primer to amplify the yeGFP-mODC CDS from the pSD01 plasmid. Has overhang sequences containing plasmid sequence upstream of 5’TADH1 and from 5’TADH1
SD9	tatactttaacgtcaaggagatgggatcctctaaaggtgaagaattattc	Forward primer to amplify the yeGFP-CLN2 CDS from pITGFP89 plasmid. Has overhang sequences from the 3’PGAL1.
SD10	gcttatttagaagtggcgcgccctaagatcttattacttgggtattgcccatac	Reverse primer to amplify the yeGFP-CLN2 CDS from pITGFP89. Has overhang sequences containing plasmid sequence upstream of 5’TADH1 and from 5’TADH1
SD16	tatactttaacgtcaaggagatggtctccaaaggtgaagaactgtttacag	Forward primer to amplify the yeGFP-mODC CDS from the pSD01 plasmid. Has overhang sequences from the 3’PGAL1
SD23	ggggttccgcgcacatttccc	Plasmid specific reverse primer to screen for multiple genomic integration events at the LEU2 –BstEII region.
SD24	ggaggtcgactacgtcgttaaggc	Yeast chromosome III specific reverse primer annealing 458 bps downstream of the endogenous LEU2 CDS. used for PCR screen for single genomic integration event.
SD25	cccaacagttgcgcagcctgaatgg	Plamisd specific forward primer to be used with either SD23 (for multiple genomic integration) or SD24 (for single genomic integration)
SD26	ccgtaaaaggaaattacatggcgagtgtcacataatagcgacggatccccgggttaattaaggcg	BAR1 gene deletion: Forward primer to amplify the His3MX cassette from pFA6-his3MX. Has 43bps of overhang sequences from 214bps upstream of endogenous BAR1 gene.
SD27	gcttgtcgcgtgccagatcggggttcaattccccgtcgcgcgagctcgtttaaactggatggc	BAR1 gene deletion: Reverse primer to amplify the His3MX cassette from pFA6-his3MX. Has 40bps of overhang sequences from 200bps downstream of endogenous BAR1 gene.