TABLE 2.
Gene and probe | Sequencea | Position | Specificity |
---|---|---|---|
vacA s region | |||
P1S1a | GGAGCRTTRGTCAGCATCAC | 61–80b | s1a |
P22S1a | GCTTTAGTAGGAGCRTTRGTC | 52–72b | s1a |
P1S1b (S1b) | GGAGCGTTGATTAGYKCCAT | 61–80b | s1b |
P2S1b | GTTTTAGCAGGAGCGTTGA | 52–72b | s1b |
P1S2 (VAS2) | GCTAAYACGCCAAAYGATCC | 88–107c | s2 |
P2S2 | GATCCCATACACAGCGAGAG | 103–122c | s2 |
vacA m region | |||
P1M1 | TTGATACGGGTAATGGTGG | 1526–1544b | m1 |
P2M1 | GGGTAATGGTGGTTTCAACA | 1533–1552b | m1 |
P1M2 | ACGAATTTAAGAGTGAATGGC | 1522–1542c | m2 |
P2M2 | AGAGCGATAACGGGCTAAACA | 1577–1597c | m2 |
cagA | |||
cagApro1 | GTTGATAACGCTGTCGCTTC | 94–113d | cagA |
cagApro2 | TAATCTTCARGTRGCTTTTCTT | 68–89d | cagA |
R is A or G, W is A or T, Y is C or T, and K is G or T.
Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain 60190 (GenBank accession no. U05676) for s1 and m1.
Nucleotide position numbers are according to the start codon of the vacA open reading frame in strain Tx30a (GenBank accession no. U29401) for s2 and m2.
For cagA the positions are according to the start codon of the cagA open reading frame in the sequence of the strain with GenBank accession no. L11714.