Abstract
Transcription factors play an indispensable role in maintaining cellular viability and finely regulating complex internal metabolic networks. These crucial bioactive functions rely on their ability to respond to effectors and concurrently interact with binding sites. Recent advancements have brought innovative insights into the understanding of transcription factors. In this review, we comprehensively summarize the mechanisms by which transcription factors carry out their functions, along with calculation and experimental-based methods employed in their identification. Additionally, we highlight recent achievements in the application of transcription factors in various biotechnological fields, including cell engineering, human health, and biomanufacturing. Finally, the current limitations of research and provide prospects for future investigations are discussed. This review will provide enlightening theoretical guidance for transcription factors engineering.
Keywords: Transcription factors, Binding sites, Database-based prediction, Experimental identification, Cell engineering, Biomanufacturing
Graphical abstract
1. Introduction
Transcription is a crucial component of the central dogma of molecular biology (DNA-RNA-protein) [1], serving as a bridge that translates genetic information into diverse forms at the individual level. Transcription factors (TFs) play a pivotal role in regulating the transcription of target genes by selectively recognizing and binding specific DNA regions known as TF binding sites (TFBSs), typically located in the promoter region [2]. This mechanism allows for the differential expression of genes throughout the genome. TFs can exert control over processes that specify the developmental patterns of plant and animal cells, thereby driving cell differentiation [3]. In the case of microbial cells, TFs play a systematic role in regulating the finely tuned expression of numerous genes within the metabolic network, ensuring efficient growth and reproduction [4]. In terms of its impact on human health, dysfunction of TFs often results in misregulated gene expression [5,6], leading to various diseases and syndromes that pose a risk to human well-being [7]. Consequently, a comprehensive understanding of TFs and their effective utilization holds significant potential for advancing both the production of high-value bio-products and human healthcare.
The study of TFs has been a subject of considerable interest, and there is a desire to transition from relative unfamiliarity to their efficient application [8]. The general methodology employed to achieve this goal can be succinctly summarized as follows: Firstly, TFs are screened and their fundamental characteristics and functions, including subcellular localization and interacting proteins [9,10], are comprehensively elucidated [11]. Subsequently, based on this valuable information, potential application domains are explored where TFs can be efficiently customized to exert high biological functionality, such as contributing to human health or biomanufacturing [12]. In the subsequent development, it is imperative to focus on the development of novel technologies for identifying and characterizing TFs. Moreover, a broader range of cross-cutting areas in biology should be explored and adapted to fully unleash the competitive potential of TFs as a versatile tool.
Although TFs can control the transcription of target genes through various mechanisms [13], these mechanisms fundamentally rely on their interactions with TFBSs. Therefore, the identification of TFBSs is a crucial research concern. In order to fulfil this task, many highly innovative techniques have been rapidly developed. These include both specific experimental [[14], [15], [16], [17]] and calculation methods [[18], [19], [20]]. The latter can be described in more detail as a bioinformatics-based strategy for predicting TFBSs. This is accomplished by integrating a vast amount of experimental data into databases and employing big data algorithms for analysis and calculation. These two strategies can collaborate to facilitate the identification of TFs and TFBSs [21], particularly with significant improvements in accuracy and throughput.
Recently, there has been no systematic review on the universal mechanisms of TFs, including the recent achievements in the field of TFs and TFBSs identification. Additionally, the potential contribution of TFs to biotechnological applications has not been highlighted. In this review, these concerns are systematically summarized and discussed. The objective is to provide a comprehensive perspective on TFs research to meet the current research needs and inspire valuable insights for future research directions.
2. Transcription initiation
The transcription of genes is catalyzed by the holo-RNA polymerase (RNAP), which contains five subunits (α2ββ’ωσ) (Fig. 1) [13]. Among these components, α2ββ’ω plays a catalytic role, facilitating enzymatic activity, while the σ factor is responsible for recognizing promoters and directly binding to its conserved −10 and −35 regions [22].
Fig. 1.
Simplified schematic overview of the transcriptional complex reconstruction at 3.9 Å resolution and class I/II transcription activation mechanisms.
Taking the transcription of sugar metabolism-related genes in bacteria as an example, transcription initiation requires the assistance of cyclic adenosine 3′,5′-monophosphate (cAMP) and its receptor, catabolic gene activator protein (CAP). The active CAP binds to the promoter DNA upstream of the RNAP to activate transcription [23,24]. CAP-dependent promoters can be classified into two activation models based on the different binding positions of CAP on the promoter. In the case of class I, CAP binds to the promoter DNA located in the −61.5 region. Transcription activation can be achieved through the “recruitment” mechanism, whereby CAP interacts with the C-terminal domain of the α subunit (αCTD) of RNAP [25]. In the case of class II, the CAP binding site is situated at the −41 region, which coinciding with the −35 region of the promoter. CAP interacts with the σ subunit of RNAP, inducing conformational changes in RNAP and facilitating the process of transcription activation [26]. Recently, the structures of both class transcriptional complexes were successfully resolved using high-resolution cryo-electron microscopy. As a result, several authentic microscopic phenomena have been accurately depicted, such as the spatial conformation of the opened promoter DNA [27], the bending angle of the DNA strand in the transcriptional complex and the interacting residues in the CAP-αCTD region [28,29].
TFs actively engage in the transcriptional complex, exerting their regulatory influence on transcription intensity by either activating or repressing it.
3. TFs control the transcription
TFs usually contain at least two core structural domains, namely the DNA binding domain (DBD) and the effector domain (ED) (Fig. 2a) [21]. The DBD, which often includes helix-turn-helix (HTH), helix-loop-helix, zinc finger or leucine zipper motifs [30], is primarily responsible for specifically recognizing and binding to their respective TFBSs. On the other hand, the ED serves as the regulatory domain involved in signal sensing. It can bind various intracellular metabolites, including: CoA [31,32], cofactors [NADP(H), NAD(H) [33]], sugar metabolites [pyruvate [34], glucosamine6-phosphate [35], fructose-1,6-diphosphate [36]], amino acids [lysine [37]]. Additionally, changes in the external environment (Fig. 2b), such as pH [38], temperature [39], light [40], dissolved gas [[41], [42], [43]] or cell density [[44], [45], [46]], can also act as signals for induction. The induction signal can trigger the binding or dissociation of a TF to a specific DNA region. Since this process mainly occurs in the promoter region, it often impacts the efficiency of RNAP in carrying out its transcriptional function. In other words, the TF, consisting of two structural domains with differentiated functions, forms a unified entity that cooperatively regulates gene transcription by responding to intra- or extracellular signals.
Fig. 2.
Work mechanism of TFs. A Structure of TFs. Effector domain receives the corresponding signal that allows the TF to bind or dissociate from the binding site located at the promoter of its regulon gene. B Some examples of signaling molecules. C Effectors contribute to the function of TFs. D Mechanisms of activation and repression of regulated genes by TFs.
TFs can be classified into multiple families based on their unique structures and functions. Table 1 provides examples of TF families along with their typical characteristics. These TFs regulate various pathways within the metabolic network and can act as preferential repressors or activators, or even display dual regulatory roles. Importantly, the presence of distinct TFBSs for each family ensures a high level of orthogonality in regulating their respective pathways, preventing random cross-interference.
Table 1.
Some TFs families.
| Family | Example | Action | Some regulated functions | Characteristics of TFBSs | DBD position | Reference(s) |
|---|---|---|---|---|---|---|
| TetR | MexZ, QacR, AcrR. | Repressor | Biosynthesis of antibiotics, efflux pumps, osmotic stress, etc. | Inverting palindrome sequences. e.g. 5′TACATACATTTGTGAATGTATGTA -3’. | N-terminal | [105,106] |
| GntR | FadR, McbR, GabR. | Repressor | General metabolism | Inverted or direct repeat sequences. e.g. 5′TNG(N)nCNA-3′. | N-terminal | [107] |
| LysR | Activator/repressor | Carbon and nitrogen metabolism | Interrupted palindrome sequences. e.g. 5′ATC-N9-GAT-3′. | N-terminal | [108] | |
| AraC | Activator | Carbon metabolism, stress response and pathogenesis | Asymmetrical and highly AT-rich sequences. e.g. 5′GATATAAN3TAN-3′. |
C-terminal | [109,110] | |
| MerR | SoxR, BltR, BmrR. | Activator | Resistance and detoxification | Dyad symmetrical sequence. e.g. 5′ACCTCAAGTTTGCTTGAGGT-3′. | N-terminal | [111,112] |
| CRP | CAP, RedB, FNR. | Activator/repressor | Global responses, catabolite repression and anaerobiosis | Two inversely-repeated sequence. e.g. 5′TGTGANNNNNNTCACA-3′. | C-terminal | [113,114] |
While the specific mechanisms of action may vary among different families of TFs, the fundamental nature of these signaling molecules as effectors remains consistent. Their essential role is to modulate the binding affinity between the TF and its associated TFBS DNA, either promoting binding or facilitating dissociation. Effectors achieve this objective through various pathways (Fig. 2c), including direct interactions or signal transduction cascades. For instance, effectors can directly interact with TFs, as seen with the malate-responsive TF, MalR [16], or activate activators for TFs, such as the glutamine-responsive TF, GlnR [47]. Effectors can also truncate redundant sequences within the TFs, as demonstrated by the pH-responsive TF, PacC [48,49]. Furthermore, effectors can induce oligomerization, as observed in the temperature-sensitive TF, Hsf [50], or phosphorylate TFs, like the glucose-responsive TF, CcpA [51].
4. TFs adopt a unique mode of operation
TFs are typically classified into activating and repressing types based on their functions, which have highly positive or negative effects on transcription initiation, respectively. Considering the dual-functional impact of effectors on the interaction between TFs and their TFBSs (promoting binding or dissociation), Fig. 2d focuses on the “promoting binding” to illustrate the relevant mechanism. In the case of transcriptional activation, this can be achieved through the recruitment of RNAP by TFs. It can also occur due to the improved spatial conformational adaptation of the promoter's double-stranded DNA to RNAP resulting from TFs binding [52]. On the other hand, transcriptional repression seems to have more diverse mechanisms compared to activation. These mechanisms include: (1) Steric hindrance. The TFBS overlaps with the RNAP-binding site, creating direct competition between the TF and RNA polymerase for the cis-acting locus (the conserved −10 or −35 promoter element) [53]. (2) Roadblock. The binding of a TF and its TFBS located downstream of the transcription initiation region forms a roadblock for transcription elongation, hindering the progression of RNAP [54]. (3) Deformation. Repression can occur when the repressor simultaneously binds to motifs located upstream and downstream of the promoter, leading to significant deformation of the promoter DNA. This deformation can cause a mismatch between the promoter and RNAP, inhibiting transcription [55]. (4) Anti-activation. Repression can be achieved through the TF acting as an “anti-activator”. This occurs when the repressor competes with an activator due to the overlap of their TFBSs or interacts with the activator, thereby inhibiting transcription [56]. (5) Difficult promoter clearance. Repression may occur by preventing promoter clearance due to the interaction of the TF with RNAP, hindering the initiation of transcription [57].
TFs typically function as homodimers or multimers rather than in a monomeric state, which is a distinct characteristic of their mode of operation. This can perhaps be attributed to the fact that the DNA sequences recognized by TF monomers do not contain enough information, making it challenging to precisely extract regulated genes from the vast background of randomly occurring sequences in the genome. In contrast, oligomerized TFs can greatly enhance the affinity and specificity of transcriptional regulatory binding, as the cis-regulatory sequences they recognize are palindromic repeats with double the length. This may represent the most effective strategy evolution has retained to achieve precise regulation by multiple TFs for multiple genes with a high level of orthogonality. It is worth noting that TFs can also function as monomers to regulate target genes. For example, the TF, Gcr1U regulates glycolytic genes in Saccharomyces cerevisiae, Spx regulates oxidative stress-related genes in Bacillus subtilis [58,59]. Additionally, there are TFs that function as tetramers, such as MYC2 derived from plants [70]. The oligomeric complex of MYC2 mediates the formation of DNA looping to enhance transcription of target genes. Considering that the vital biological functions of TFs rely on their interactions with specific TFBSs, the identification of them has emerged as a significant research topic. The notable accomplishments in this field warrant comprehensive summarization and discussion.
5. Identification of TFs and TFBSs
In general, two strategies can be employed to identify TFs and TFBSs as depicted in Fig. 3a. Each strategy has its own unique characteristics. Experiment-based strategies offer objective and reliable results but often demand a considerable amount of labor-intensive work. On the other hand, calculation-based strategies, relying solely on computer programs and algorithms, can greatly reduce manual labor but may compromise to some extent on accuracy.
Fig. 3.
Prediction of TFs and their matching TFBSs. A Strategies based on calculation and experimentation are used to identify TFs and TFBSs. B Workflow scheme for TFs and target regulon gene prediction.
5.1. Experimental methods for identification of TFs and TFBSs
Accurate identification of TFs and TFBSs is a prerequisite for their practical application in the field of biotechnology. To achieve this goal, numerous ingenious experimental methods have been developed in recent years. It is noteworthy that these experiments need to be carefully designed, taking into account the distinction between the known and the unknown entities.
5.1.1. Gene-centered experimental methods
Yeast one-hybrid is a classical method used to identify the specific TFs that transactivate a particular gene. It is also the only method that allows researchers to identify upstream regulators of a specific biological process [60]. The main objective of yeast one-hybrid can be summarized as determining which TFs specifically bind to a given TFBS.
Although this technique has proven to be valuable in problem-solving and has undergone gradual improvements to enhance its desirability, there are certain limitations to be aware of. It is possible for an endogenous yeast expression activator to bind to the bait DNA binding site and activate the reporter gene, leading to a potential omission of the corresponding target gene fragment. Additionally, the inserted target element may interact with the yeast endogenous TF, resulting in the loss of DNA binding ability in the DBD region of the target element and consequently omitting the target gene. To address this challenging issue, a refined yeast one-hybrid system can be achieved by using two independent bait sequences [61] or two reporter genes [62]. This approach efficiently suppresses the occurrence of false positives. However, the application of this technique is still limited in certain cases, such as the inability to retrieve heterodimeric TFs or the challenge of identifying low-abundance TFs in cDNA libraries. Therefore, it is necessary to further improve this technology to address these issues or develop a novel technique that is urgently needed.
5.1.2. TF-centered experimental methods
In contrast to the uniqueness of the strategies mentioned above, there are numerous alternative approaches available for identifying TFBSs of specific TFs.
5.1.2.1. Differential expression of TFs for identifying regulatory genes
Overexpression or silencing of specific TFs can induce changes in the transcript levels of their target genes, which can be observed through transcriptomic data analysis. Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis can then be utilized to identify the target genes. These genes with altered transcript levels are considered to be regulated by the specific TF (Fig. 4a). Additionally, this approach can provide insights into the activation or repression functions exerted by the TF on specific genes within relevant pathways. For instance, overexpressing the TF RamA in Corynebacterium glutamicum [63], or PsrA in Serratia marcescens [12] can yield valuable information. In addition to endogenous TFs, exogenous TFs can also be expressed. For instance, Li et al. [64] overexpressed the TF KmHSF1 and KmMSN2 from thermotolerant Kluyveromyces marxianus in Saccharomyces cerevisiae, resulting in significant changes in the expression levels of 50 and 55 genes, respectively.
Fig. 4.
Strategies for identifying TFBSs. A The genes regulated are identified by comparing transcriptomic changes in specific TF upon overexpression and silencing. B Chromatin immunoprecipitation-based identification strategy. C Schematic diagram of the CUT&RUN strategy.
Although convenience and efficiency are significant advantages of this approach, there is an obvious limitation that arises from it. It becomes challenging to interpret which genes are directly controlled by the TF through its binding to the regulatory elements of the gene, and which genes are influenced indirectly through cascade effects on other regulatory proteins. In other words, the different patterns of gene expression resulting from the overexpression or lack of expression of a TF cannot distinguish between its direct and indirect effects. This ambiguity can lead to confusion regarding the sequence of events triggered by TF activity, making it difficult to accurately piece together the sequence of regulatory events involved in a specific biological process. In light of this, methods based on immunological techniques can be instrumental in identifying direct protein-DNA interactions.
5.1.2.2. Chromatin immunoprecipitation (ChIP) and its derivative technology
ChIp is the most commonly used technique to address the crucial question of where TFs bind in the genome. The standard ChIP assay typically begins with the formation of a covalent linkage between the DNA-binding protein and the bound DNA using a chemical cross-linking reaction, usually with formaldehyde. This cross-linking step is followed by shearing of the chromatin into protein-DNA complexes of a specific length, often achieved through ultrasound. The sheared chromatin is then incubated with an antibody that specifically recognizes and binds to the target protein (TF). Subsequently, the cross-links are reversed, the DNA is purified, and finally, the enriched DNA fragments are subjected to high-throughput sequencing [65]. (Fig. 4b). ChIP has proven to be an effective method for identifying potential TFBSs within the genome and has been widely utilized in various species. For instance, it has been used to discover TFBSs for a large population of TFs in yeast [66,67], identify direct targets TFBSs of the Caenorhabditis elegans TF, DAF-16 [68], and identify the STAT3's TFBSs in human B cell [69].
The advantage of the ChIP technique is that it provides clear evidence that the binding between proteins and DNA is actually occurring within the cell, since the binding takes place in the in vivo environment. Additionally, by comparing the sequencing results to the annotated whole genome, the distribution and specific location of TFBSs across the entire genome can be determined. However, while these techniques can identify TFBSs, they do not reveal the specific regulatory function performed by the TFs on target genes (activation or repression). To determine the exact regulatory function, subsequent differential expression analysis of TFs is required. This analysis is distinct from the differential expression analysis of TFs without ChIP, as it involves an independent experiment on a small set of candidate target genes identified based on the sequencing results.
To address certain limitations of ChIP, such as the requirement for a large number of starting cells for chromatin DNA purification and the lower signal-to-noise ratio resulting from sequencing whole genome fragments, several highly innovative and remarkable approaches have been developed based on the ChIP method. One such example is the Cleavage Under Targets & Release Using Nucleas (CUT&RUN) technique, which was developed by Peter et al. [70]. In this technique (Fig. 4c), a TF-specific antibody fused with a calcium-inducible MNase, this protein complex can bind to the TFBSs within intact cells and cleave the adjacent DNA adjacent to them. The cleaved DNA fragments are then carried by the protein complex and released from the cell for subsequent sequencing. This method differs from ChIP, where the entire genome is initially fragmented, resulting in background noise in the sequencing of the entire genome. In CUT&RUN, DNA fragments are only cleaved around the binding sites, effectively reducing background noise during sequencing while retaining the advantages of the in situ approach. Moreover, this method allows for the use of a lower number of starting cells and can be automated using magnetic beads. While ChIP-based techniques such as CUT&RUN are powerful tools for studying TF binding, they have limitations. One major limitation is that they are endpoint measurement-based techniques, which means they cannot capture dynamic changes in TF binding in real-time. Additionally, the construction of specific antibodies that successfully bind to TFs can be challenging and may introduce experimental variability. To overcome these limitations, non-immune-dependent techniques that do not rely on antibodies have been developed for the efficient identification of TFBSs.
5.1.2.3. Un-immunoprecipitation dependent technology based identification
The un-immunoprecipitation dependent technique offers an alternative to the challenges associated with obtaining high-quality specific antibodies, as it operates on a fundamentally different principle. One such technique, called “DamID” (DNA adenine methyltransferase identification), utilizes the recognition ability of DNA adenine methyltransferase (DAM) by fusing it with a TF [71] (Fig. 5a). In this method, when the fusion protein is expressed in vivo, DAM preferentially methylates specific base sequences (GATC) near the TFBSs. The methylated regions can extend thousands of bases away from the binding site due to the diffusion of DAM. Moreover, since the base sequence GATC occurs at a relatively high frequency in the genome, almost every region can be detected using this technique. Subsequently, the genomic DNA is digested with DpnI (only cuts methylated GATC) or DpnⅡ (only cuts no-methylated GATC). This is followed by southern blot or PCR-based quantification of methylation frequencies, enabling the mapping of TFBSs across the entire genome. DamID offers several advantages, such as the detection of TF-TFBS interactions in living cells and the ability to achieve reliable results even with low levels of expression of the Dam fusion protein. This reduces the likelihood of interference with the function of the endogenous protein or its target. However, DamID does have limitations. The method's resolution is relatively low, limited to approximately 1 kilobase (kb), which restricts its utility for precise mapping of TFBSs. Additionally, extensive methylation can be toxic to cells, posing a challenge for experiments that require extended periods of methylation.
Fig. 5.
Un-immunoprecipitation method to identify TFBSs. A DAMID strategy based on methylation of sequences adjacent to the binding sites and determination of the binding sites based on the methylation frequency. B 3D-seq strategy based on introduction of base-specific mutations adjacent to the binding sites and determination of the binding sites based on mutation frequency. C “calling card” strategy based on transposition technology.
In response to the aforementioned limitations, researchers have made significant advancements in developing innovative tools with alternative approaches. For instance, Larry et al. have introduced a novel tool called “3D-seq,” which utilizes nucleic acid-targeting deaminases. This class of proteins is capable of inducing mutations in both DNA and RNA molecules [72]. In this technique (Fig. 5b), a modified cytosine deaminase called DddA, which preferentially acts on double-stranded DNA, is fused downstream of the TF. When the TF binds to its target TFBSs, DddA induces base pair substitutions (G-C to A-T) in the vicinity of the TFBSs. Through sequencing comparisons with appropriate controls, the average frequency of these conversion events can be determined, providing valuable information about TFBSs. Additionally, the system's controllability is enhanced through the introduction of auxiliary ligands regulated by the arabinose promoter. However, it is important to acknowledge the potential limitations of this technique. The resolution of the method is dependent on the frequency of cytosines found within the context of DddA-preferred sequences. While these sequences occur, on average, once every 10 base pairs, their frequency may vary within specific regions of the genome. This variability can significantly reduce the resolution of the technique in those particular regions.
Transposon technology has also emerged as a valuable approach for TFBSs identification [73]. For instance, Wang et al. developed a novel method called the “calling card” method (Fig. 5c). The underlying principle can be summarized as follows: When a transposase is fused to a TF, it induces the integration of a transposon into the genome near the TFBSs. Following transposition, cells that have undergone transposition are selected, and their genomic DNA is extracted. The transposon-containing fragments are then cleaved near the transposon ends using a restriction enzyme, and the resulting fragments are ligated to circularize them. The genomic DNA adjacent to the transposon end is subsequently amplified through reverse PCR, and the sequence of the reverse PCR product, representing a specific genomic DNA sequence near the TFBSs, is identified through sequencing. The obtained sequences are then compared to the original genome to determine the insertion locations, thereby revealing the TFBSs locations. To summarize, the “calling card” method utilizing transposon technology allows the transposase, guided by the TF, to leave a distinct marker or “calling card” in the proximity of TFBSs within the genomic regions. This “calling card” can be identified and serves as a record of the genomic regions visited by the TF. This approach offers advantages over the limitations associated with DamID and 3D-seq techniques mentioned earlier. However, it is important to note that the transposition efficiency in this method is relatively low. This means that not all TF binding events may result in successful transposon integration and “calling card” formation. Consequently, the method may not capture the complete repertoire of TFBSs.
As evident from the given examples, it becomes apparent that there may not be a single universal solution that can address all limitations. Instead, trade-offs must be considered to select the optimal strategy based on specific requirements. While the aforementioned in vivo techniques offer valuable insights into TF regulation targets within their natural context, they do encounter challenges in achieving substantial enrichment of binding fragments in samples and conducting biophysical characterization and quantification of protein-DNA interactions. To address these limitations, relevant in vitro-based strategies such as electrophoretic mobility shift assay (EMSA) [74], surface plasmon resonance (SPR) [75], DNA microarray-based interaction technology (MITOMI) [76], or protein-binding microarrays (PBM) [15] can be utilized.
5.2. Calculation methods for prediction of TFs and TFBSs
With the rapid development of bioinformatics, molecular biology databases now offer a vast array of nucleotide and amino acid sequences. Analyzing and computing these sequences has emerged as the fastest and most effective method for discovering new genes and predicting protein structures. Among the crucially conserved regions of TFs, the DBD and ED exhibit minimal alterations during the extensive process of evolution, ensuring the accurate execution of their regulatory functions. Consequently, these conserved structural domains enable the prediction of TFs and TFBSs through bioinformatics methods that rely on sequence homology analysis [77].
Considering the molecular mechanisms through which TFs exert their regulatory functions primarily involves the interaction between TFs and their corresponding TFBSs, it becomes possible to make predictions about one based on the knowledge of the other. In other words, two strategies are employed (Fig. 3b): the TFs-centered method, which aims to predict TFBSs, and the gene-centered method, which aims to predict TFs. Despite their distinct approaches, both strategies are integrated into the same workflow model of “input-align-output”.
Given the labor-intensive nature of experimentally searching for targets across a wide range of proteomes and genomes, calculation-based validation approaches using databases have become the preferred choice. The field of bioinformatics has witnessed rapid development, leading to significant enrichment of TFs-related databases and improved accuracy of predicted results. These databases cater to specific species, such as mouse, human, plant, E. coli, and more. Furthermore, there are comprehensive databases that integrate common species across taxonomies, encompassing not only the aforementioned species but also others like Drosophila melanogaster, Caenorhabditis elegans, birds and reptiles (Table 2).
Table 2.
TFs related databases.
The calculation-based approach described above, while providing a reasonable level of accuracy in most cases, encounters a significant limitation when attempting to predict proteins that lack homology with the reported TFs. This limitation poses a challenge for calculation that rely on homology alignment. In essence, these databases may be unable to answer the question of whether a protein is a TF or not when it lacks homology with known TFs.
6. Applications based on the pair TFs and TFBSs
The successful identification of TFs, target gene maps, and their corresponding TFBSs not only enables a comprehensive understanding of regulatory mechanisms at a genome-wide level but also holds significant potential for various applications, including disease treatment, drug development, and microbial production. By maximizing their appropriate utilization, these findings can make substantial contributions in these fields.
6.1. Induced directed differentiation in stem cell engineering
Stem cells have an extraordinary ability to expand limitlessly and differentiate into diverse cell types. However, the lack of dependable protocols for generating cell lines and the need for lengthy time periods present challenges to their efficient application. Current protocols primarily rely on external signals, often mediated by TFs, to regulate the genetic programs that drive specific cell types. Nevertheless, this method necessitates prolonged stimulation with external signal factors, and achieving multiple lineage cell variations within a single culture is often challenging.
Thus, in theory, cell differentiation can be directly induced by activating one or a subset of TFs through genetic manipulation using molecular biology techniques, bypassing the need for specific external environmental signal factors like pharmacological agents or bioactive proteins (Fig. 6a). By directly activating specific TFs, the time required for cell conversion can be shortened. Previous studies have demonstrated the powerful potential of TF induction in stem cell differentiation and reprogramming somatic cells into pluripotent cells. For instance, the combined expression of TFs, Brn2, Ascl1, and MytL1 can convert human pluripotent stem cells (hPSCs) into functional neurons [78]. Additionally, the expression of a single TF, Ngn2, can induce the development of embryonic stem cells (ESCs) into mature neuronal cells in less than 2 weeks [79]. Conversely, the expression of specific TFs can also induce somatic cells into pluripotent stem cells, as seen in the induction of pluripotency in mouse embryonic and adult fibroblasts [80].
Fig. 6.
Application of TFs in stem cell engineering. A Direct genetic manipulation of TFs genes for directed differentiation of pluripotent cells. B Workflow for determining the role of specific TF in determining the direction of cell differentiation.
However, in order for this strategy to be applicable to humans, a crucial question arises: among the approximately 1600 TFs in the human body that have not been comprehensively tested, which of them can lead to targeted cell differentiation? This essentially raises the question of how to accurately select the appropriate target TF. To address this challenge, a computer-guided calculation-based strategy called IRENE has recently been developed to identify specific and more efficient TFs while maintaining a higher level of confidence [81]. Additionally, several other similar systems have been proposed [82]. Furthermore, innovative experimental methods with higher theoretical confidence have been employed (Fig. 6b). It begins with constructing a comprehensive TF library, followed by transducing the library into hPSCs and inducing their overexpression. Different cell types are then sorted based on the specific TF overexpression, and transcriptome sequencing is performed. Finally, the differentially expressed TF genes are analyzed using clustering and fitness estimation. This approach allows for the mapping of the gene module network and the identification of the specific TFs that contribute to determining the direction of cell differentiation. In doing so, hPSCs have been successfully programmed into neurons, fibroblasts, oligodendrocytes and vascular endothelial-like cells [83]. Furthermore, KLF4 and KLF5 were identified to promote the development of epithelial cells [84]. These findings suggest that TF-based programming for cell engineering can be systematically investigated and holds great promise for various applications.
The aforementioned strategy indeed holds potential in elucidating the role of TFs in cell differentiation. However, it is worth noting that lentiviral vectors carrying TF libraries have a limited infectivity in stem cells, which may lead to unintentional omissions in the search for functional TFs. Therefore, further research should concentrate on exploring the extent to which combinatorial TF expression can generate specialized cell types. Additionally, it is essential to develop orthogonal programming strategies that can fulfill the requirements of diverse applications based on this approach.
6.2. Contributions to human health
In the human genome, there are more than 1600 TFs, and approximately 19% of them have been closely associated with at least one disease [77], including cancer. Transcriptional dysregulation plays a crucial role in the development of numerous diseases, and even a dysregulation in a single TF can have profound consequences, leading to changes in cell fate [85]. TFs are integral components of the transcriptional program and have direct regulatory effects on target genes, making them more specific for disease regulation compared to upstream signaling proteins like kinases [86]. This higher specificity makes TFs highly significant in targeted therapy for diseases.
The regulatory balance of the human metabolic network is fundamental for maintaining the health and normal functioning of the organism, and human TFs play a crucial role in this dynamic balance. Abnormalities in the expression levels or functions of TFs directly impact human health (Fig. 7). Certain diseases are associated with overexpression of specific TFs. Examples include T cell acute lymphoblastic leukaemia [87], atherosclerosis [88], systematic lupus erythematosus [89]. Targeting these TFs through strategies such as inhibiting their transcription or introducing inactivating mutations, and targeted degradation can significantly disrupt the disease progression. Conversely, diseases caused by loss-of-function mutations in TFs, such as congenital heart, maturity-onset diabetes of the young [90], and IPEX syndrome [91], may benefit from therapeutic strategies involving the targeted use of agonists against related TFs to restore overall function.
Fig. 7.
The principle of TFs can contribute to human health. The balanced network of transcription factors maintains a healthy state, while their dysregulation causes the corresponding disease.
Furthermore, the use of small molecules to modify TFs and treat diseases caused by TF abnormalities is an attractive option [92]. However, TFs are generally considered “undruggable” because they often lack binding pockets for small molecules. The specialized DBD of TFs, such as zinc fingers, are typically optimized to recognize specific DNA sequences and stabilize TF-DNA interactions. This structural and functional characteristic make TFs unsuitable for accommodating small molecules [93]. Nevertheless, significant progress has been made in recent years in the engineering of small molecule modulators for TFs, thanks to the development of interdisciplinary fields such as molecular biology, structural biology, and virtual screening. Considering the mechanism of TF action, the ED can serve as an intrinsic control point for modulating transcriptional activity, and it has been traditionally regarded by medicinal chemists as the most promising target for the development of effective TF modulators. A notable accomplishment in this regard is the development of the androgen receptor antagonist enzalutamide [86]. Its pharmacology can be succinctly described as competitively inhibiting the binding of androgens to their receptors, which are TFs. Consequently, enzalutamide effectively hinders the receptors from binding to DNA [94]. This drug received FDA approval in 2019 due to its demonstrated efficacy in treating castration-resistant prostate cancer (CRPC).
It is crucial to acknowledge that aforementioned are based on the assumption that we already possess knowledge about the aberrantly expressed TFs. However, precisely determining them is a challenging task. Current large-scale studies on TFs primarily rely on RNA sequencing (RNA-seq). Nevertheless, predicting TF expression levels based on quantitative transcriptome data is difficult due to their low correlation coefficient [95]. Similarly, at the proteomic level, the accurate identification and quantification of TFs pose challenges due to their low expression abundance and the lack of relevant enrichment techniques [96]. Fortunately, a recent development involves a method to identify outlier TFs at the proteomic level [97]. This strategy utilizes synthetic DNA containing a concatenated tandem array of consensus TF response elements to enrich TFs. Following pulldown, coupled with mass spectrometry (MS) techniques for analysis, it ultimately enables the identification of aberrantly expressed outlier TFs. This approach undoubtedly deepens our understanding of how TFs perform their regulatory functions in tissues and provides a theoretical foundation for designing drugs that target TFs.
6.3. Contributions to microbial cell factory
With the advancements in metabolic engineering and synthetic biology, engineering TFs has emerged as a crucial strategy to enhance the performance of microbial cell factories [63]. In recent years, significant progress has been made in developing efficient metabolic engineering components based on the working mechanisms of TFs. These innovations have found applications in the biosynthesis of high-value-added products (Fig. 8). Several noteworthy applications deserve mention.
Fig. 8.
Applications of TFs engineering in microbial cell factories. Designed as a logic gate for application to genetic circuits; developed into biosensors as high-throughput screening tools; transcriptional modifications based on hybrid promoters to construct toolkits that can be used for fine tuning; introduction of environmental response elements for dynamic regulation.
Logic gates play a crucial role in controlling the expression of outputs by receiving and processing various input signals. The interactions between TFs and TFBSs form the basis for signal integration and calculation. There are three fundamental types of logic gates: “AND” gate, “OR” gate, and “NOT” gate. By selectively cascading these basic gates, more advanced forms can be obtained to meet higher requirements. The assembly of logic gates and pathway genes can create ideal genetic circuits that enhance the yield of biosynthesis. For instance, improved production of N-acetylglucosamine [35] or 2′-fucosyllactose [98] has been achieved through the implementation of such genetic circuits. A comprehensive review on the contribution of genetic circuits to metabolic engineering has been described by Seong et al. [99], providing detailed insights into this topic.
Biosensors have emerged as powerful intracellular detection tools for specific metabolites, offering high efficiency, accuracy, and simplicity. They operate on the principle that the binding of a specific metabolite to the ED of a relevant TF can modulate the regulation of its target gene, resulting in changes in transcription and expression levels. These changes exhibit a positive correlation with the metabolite concentration. By detecting alterations in the expression of target genes, such as fluorescent proteins or screening markers, biosensors can provide a reflection of the intracellular metabolite concentration. The use of biosensors eliminates the need for laborious cell fragmentation and offers the significant advantage of high throughput. Recently, several biosensors have been developed with exceptional performance for metabolites such as malate [16], erythritol [100], niacin [101], among others. These biosensors can be utilized as a strategy for high-throughput screening of high-yielding strains from large sample mutation libraries. However, challenges still exist. For instance, not all metabolites have specific response TFs associated with them, given the vast number of metabolite species. Alternatively, some biosensors may have impractical response thresholds or exhibit poor linear correlation, limiting their practical utility.
By adjusting the position of the TFBS within the promoter, it is possible to alter the transcriptional strength of downstream genes. This strategy can be competitively applied to achieve precise regulation of specific pathways. In the study conducted by Xu et al. [34], a library of promoters with varying initiation abilities, ranging from 0.7 to 36 times compared to the wild-type promoter, was obtained through such transcriptional modifications. Similarly, Zhu et al. [36] and Yu et al. [98] achieved desirable initiation capabilities of metabolic engineering elements using a similar approach. However, predicting the effect of adjusting the position of the TFBS on the initiation ability of obtained promoters remains challenging. To enhance predictability, statistical-guided prediction methods can be employed, as demonstrated by Tian et al. [102] in their investigation of the effect of N-terminal coding sequences on gene expression. Alternatively, deep learning methods, as employed by Ding et al. [103] to fine-tune the dynamic range of biosensors by focusing on cross-ribosome-binding sites, can also provide predictive capabilities.
By leveraging the responsiveness of transcription factors to signaling molecules, dynamic regulatory systems can be designed with innovation. Microbial cell factories incorporating such dynamic regulatory systems can effectively sense external signals, such as light, pH, temperature, dissolved oxygen, and autonomously modulate the flux of internal metabolic pathways to achieve optimal metabolic balance. Dynamic regulation, as opposed to simple gene overexpression or knockout, offers the advantage of minimizing metabolic burden, thereby maximizing productivity and performance [99]. For instance, the production yield of 2′-fucosyllactose was significantly enhanced by utilizing different temperatures as effectors to trigger dynamic regulation in a Bacillus cell factory [98]. Similarly, the introduction of light-controlled dynamic regulatory strategy has been applied to improve isobutanol biosynthesis [104]. However, one common challenge in dynamic regulation is the occurrence of regulatory delays due to longer response times. This can result in the differentiation of cell subpopulations with varying productivity due to uneven sensing of signals. To address this issue, the introduction of a population quality control system would be an ideal solution.
7. Conclusions and future perspectives
TFs are of great interest due to their essential physiological functions, and their rational application, based on a comprehensive understanding of their mechanisms of action, can have significant implications for human health and industrial production. Recent advancements in this field have further strengthened our confidence to pursue further research on TFs. However, it is crucial to clarify the future focus of research in this area. Firstly, it is important to recognize that our understanding of transcriptional regulation remains fragmented and incomplete. For instance, proposed mechanisms based on in vitro binding experiments, need to be validated in their true endogenous environment. Testing their function solely in vitro or in heterologous systems may not fully reflect their actual regulatory role in native hosts. Secondly, regulators should not be studied in isolation. The interplay of multiple TFs, following specific regulatory logic, forms a complex network of actions that maintains the intracellular environment's homeostasis. While ensuring high orthogonality in the specific application of particular TFs is essential to avoid global perturbations in non-target pathways within the metabolic network. Lastly, the design of artificial TFs offers opportunities to overcome limitations associated with natural TFs. Natural TFs may have constraints such as limited versatility or weak binding to signaling molecules or DNA. Artificial design of high-performance TFs can be achieved through strategies like structural domain substitution or engineering specific effector domains that can bind specific signals.
Although TFs play crucial roles in both eukaryotes and prokaryotes, research on TFs has been more extensively conducted in eukaryotes, particularly in humans and plants. This discrepancy can be attributed to the larger genome size and greater diversity of TF families in eukaryotes, as well as the availability of shared databases for eukaryotic TF research. However, considering the significant industrial applications of prokaryotes, such as high-value biomanufacturing and environmentally friendly bioremediation, it is essential to allocate resources and research efforts towards studying TFs in prokaryotes. Furthermore, prokaryotes offer a relatively simpler genetic background, which makes it easier to unravel complex phenomena and mechanisms. The insights gained from studying TFs in prokaryotes can potentially yield generalizable mechanisms that can be applied to eukaryotes. This mutually beneficial approach can lead to a win-win situation where knowledge and discoveries from prokaryotic TF research can be flexibly applied to eukaryotes, enhancing our understanding and applications in both domains.
CRediT authorship contribution statement
Hehe He: Conceptualization, Validation, Investigation, writing original draft; Mingfei Yang: Supervision; Siyu Li: Validation, Investigation; Gaoyang Zhang: Investigation; Zhongyang Ding: Writing, Editing; Liang Zhang: Writing, Editing; Guiyang Shi: Supervision, Project administration; Youran Li: Supervision, Project administration, Conceptualization. All authors read and approved the final manuscript.
Declaration of competing interest
The authors have declared no conflict of interest.
Acknowledgements
This work was supported by National Key Research & Development Program of China (2018YFA0900504, 2020YFA0907700, and 2018YFA0900300), the National Natural Foundation of China (31401674), the National First-Class Discipline Program of Light Industry Technology and Engineering (LITE2018-22), and the Top-notch Academic Programs Project of Jiangsu Higher Education Institutions. This research grant was awarded to author Youran Li.
Footnotes
Peer review under responsibility of KeAi Communications Co., Ltd.
References
- 1.Browning D.F., Busby S.J.W. Local and global regulation of transcription initiation in bacteria. Nat Rev Microbiol. 2016;14(10):638–650. doi: 10.1038/nrmicro.2016.103. [DOI] [PubMed] [Google Scholar]
- 2.Schreiter E.R., Drennan C.L. Ribbon-helix-helix transcription factors: variations on a theme. Nat Rev Microbiol. 2007;5(9):710–720. doi: 10.1038/nrmicro1717. [DOI] [PubMed] [Google Scholar]
- 3.Fong A.P., Tapscott S.J. Skeletal muscle programming and re-programming. Curr Opin Genet Dev. 2013;23(5):568–573. doi: 10.1016/j.gde.2013.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Vakulskas C.A., Potts A.H., Babitzke P., Ahmer B.M.M., Romeo T. Regulation of bacterial virulence by csr (rsm) systems. Microbiol Mol Biol Rev. 2015;79(2):193–224. doi: 10.1128/Mmbr.00052-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Park M.H., Hong J.T. Roles of NF-kappa B in cancer and inflammatory diseases and their therapeutic approaches. Cells. 2016;5(2) doi: 10.3390/cells5020015. ARTN 1510.3390/cells5020015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lee H., Jeong A.J., Ye S.K. Highlighted STAT3 as a potential drug target for cancer therapy. Bmb Reports. 2019;52(7):415–423. doi: 10.5483/BMBRep.2019.52.7.152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lee T.I., Young R.A. Transcriptional regulation and its misregulation in disease. Cell. 2013;152(6):1237–1251. doi: 10.1016/j.cell.2013.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gao J., Du M., Zhao J., Yue Z., Xu N., Du H., Ju J., Wei L., Liu J. Design of a genetically encoded biosensor to establish a high-throughput screening platform for L-cysteine overproduction. Metab Eng. 2022;73:144–157. doi: 10.1016/j.ymben.2022.07.007. [DOI] [PubMed] [Google Scholar]
- 9.Xu Y., Zhu Z.Q. PIF4 and PIF4-interacting proteins: at the nexus of plant light, temperature and hormone signal integrations. Int J Mol Sci. 2021;22(19) doi: 10.3390/ijms221910304. ARTN1030410.3390/ijms221910304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hsu C.C., Hu C.D. Critical role of N-terminal end-localized nuclear export signal in regulation of activating transcription factor 2 (ATF2) subcellular localization and transcriptional activity. J Biol Chem. 2012;287(11):8621–8632. doi: 10.1074/jbc.M111.294272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lee U., Stuelsatz P., Karaz S., McKellar D.W., Russeil J., Deak M., De Vlaminck I., Lepper C., Deplancke B., Cosgrove B.D., Feige J.N. A Tead1-Apelin axis directs paracrine communication from myogenic to endothelial cells in skeletal muscle. Isci. 2022;25(7) doi: 10.1016/j.isci.2022.104589. ARTN10458910.1016/j.isci.2022.104589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pan X.W., Tang M., You J.J., Osire T., Sun C.H., Fu W.L., Yi G.F., Yang T.W., Yang S.T., Rao Z.M. PsrA is a novel regulator contributes to antibiotic synthesis, bacterial virulence, cell motility and extracellular polysaccharides production in Serratia marcescens. Nucleic Acids Res. 2022;50(1):127–148. doi: 10.1093/nar/gkab1186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bervoets I., Charlier D. Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology. FEMS Microbiol Rev. 2019;43(3):304–339. doi: 10.1093/femsre/fuz001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Li W., Li M., Hu L., Zhu J., Xie Z., Chen J., He Z.G. HpoR, a novel c-di-GMP effective transcription factor, links the second messenger's regulatory function to the mycobacterial antioxidant defense. Nucleic Acids Res. 2018;46(7):3595–3611. doi: 10.1093/nar/gky146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Mukherjee S., Berger M.F., Jona G., Wang X.S., Muzzey D., Snyder M., Young R.A., Bulyk M.L. Rapid analysis of the DNA-binding specificities of transcription factors with DNA microarrays. Nat Genet. 2004;36(12):1331–1339. doi: 10.1038/ng1473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zhang Y., Li Y., Xiao F., Wang H., Zhang L., Ding Z., Xu S., Gu Z., Shi G. Engineering of a biosensor in response to malate in Bacillus licheniformis. ACS Synth Biol. 2021;10(7):1775–1784. doi: 10.1021/acssynbio.1c00170. [DOI] [PubMed] [Google Scholar]
- 17.Maerkl S.J., Quake S.R. A systems approach to measuring the binding energy landscapes of transcription factors. Science. 2007;315(5809):233–237. doi: 10.1126/science.1131007. [DOI] [PubMed] [Google Scholar]
- 18.Chen D.S., Jiang S.J., Ma X.Y., Li F. TFBSbank: a platform to dissect the big data of protein-DNA interaction in human and model species. Nucleic Acids Res. 2017;45(D1):D151–D157. doi: 10.1093/nar/gkw1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Rychel K., Decker K., Sastry A.V., Phaneuf P.V., Poudel S., Palsson B.O., iModulonDB A knowledgebase of microbial transcriptional regulation derived from machine learning. Nucleic Acids Res. 2021;49(D1):D112–D120. doi: 10.1093/nar/gkaa810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tsai H.K., Huang G.T.W., Chou M.Y., Lu H.H.S., Li W.H. Method for identifying transcription factor binding sites in yeast. Bioinformatics. 2006;22(14):1675–1681. doi: 10.1093/bioinformatics/btl160. [DOI] [PubMed] [Google Scholar]
- 21.Deng C., Wu Y.K., Lv X.Q., Li J.H., Liu Y.F., Du G.C., Chen J., Liu L. Refactoring transcription factors for metabolic engineering. Biotechnol Adv. 2022;57 doi: 10.1016/j.biotechadv.2022.107935. ARTN10793510.1016/j.biotechadv.2022.107935. [DOI] [PubMed] [Google Scholar]
- 22.Cho B.K., Kim D., Knight E.M., Zengler K., Palsson B.O. Genome-scale reconstruction of the sigma factor network in Escherichia coli: topology and functional states. BMC Biol. 2014;12:4. doi: 10.1186/1741-7007-12-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Busby S., Ebright R.H. Transcription activation by catabolite activator protein (CAP) J Mol Biol. 1999;293(2):199–213. doi: 10.1006/jmbi.1999.3161. [DOI] [PubMed] [Google Scholar]
- 24.De Crombrugghe B., Busby S., Buc H. Cyclic AMP receptor protein: role in transcription activation. Science. 1984;224(4651):831–838. doi: 10.1126/science.6372090. [DOI] [PubMed] [Google Scholar]
- 25.Benoff B., Yang H., Lawson C.L., Parkinson G., Liu J., Blatter E., Ebright Y.W., Berman H.M., Ebright R.H. Structural basis of transcription activation: the CAP-alpha CTD-DNA complex. Science. 2002;297(5586):1562–1566. doi: 10.1126/science.1076376. [DOI] [PubMed] [Google Scholar]
- 26.Lawson C.L., Swigon D., Murakami K.S., Darst S.A., Berman H.M., Ebright R.H. Catabolite activator protein: DNA binding and transcription activation. Curr Opin Struct Biol. 2004;14(1):10–20. doi: 10.1016/j.sbi.2004.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Aibara S., Schilbach S., Cramer P. Structures of mammalian RNA polymerase II pre-initiation complexes. Nature. 2021;594(7861):124. doi: 10.1038/s41586-021-03554-8. [DOI] [PubMed] [Google Scholar]
- 28.Feng Y., Zhang Y., Ebright R.H. Structural basis of transcription activation. Science. 2016;352(6291):1330–1333. doi: 10.1126/science.aaf4417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu B., Hong C., Huang R.K., Yu Z., Steitz T.A. Structural basis of bacterial transcription activation. Science. 2017;358(6365):947–951. doi: 10.1126/science.aao1923. [DOI] [PubMed] [Google Scholar]
- 30.Weirauch M.T., Hughes T.R. A catalogue of eukaryotic transcription factor types, their evolutionary origin, and species distribution. Subcell Biochem. 2011;52:25–73. doi: 10.1007/978-90-481-9069-0_3. [DOI] [PubMed] [Google Scholar]
- 31.Xu P., Li L.Y., Zhang F.M., Stephanopoulos G., Koffas M. Improving fatty acids production by engineering dynamic pathway regulation and metabolic control. P Natl Acad Sci USA. 2014;111(31):11299–11304. doi: 10.1073/pnas.1406401111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Johnson A.O., Gonzalez-Villanueva M., Wong L., Steinbuchel A., Tee K.L., Xu P., Wong T.S. Design and application of genetically-encoded malonyl-CoA biosensors for metabolic engineering of microbial cell factories. Metab Eng. 2017;44:253–264. doi: 10.1016/j.ymben.2017.10.011. [DOI] [PubMed] [Google Scholar]
- 33.Wang E., Bauer M.C., Rogstam A., Linse S., Logan D.T., von Wachenfeldt C. Structure and functional properties of the Bacillus subtilis transcriptional repressor Rex. Mol Microbiol. 2008;69(2):466–478. doi: 10.1111/j.1365-2958.2008.06295.x. [DOI] [PubMed] [Google Scholar]
- 34.Xu X., Li X., Liu Y., Zhu Y., Li J., Du G., Chen J., Ledesma-Amaro R., Liu L. Pyruvate-responsive genetic circuits for dynamic control of central metabolism. Nat Chem Biol. 2020;16(11):1261–1268. doi: 10.1038/s41589-020-0637-3. [DOI] [PubMed] [Google Scholar]
- 35.Wu Y., Chen T., Liu Y., Tian R., Lv X., Li J., Du G., Chen J., Ledesma-Amaro R., Liu L. Design of a programmable biosensor-CRISPRi genetic circuits for dynamic and autonomous dual-control of metabolic flux in Bacillus subtilis. Nucleic Acids Res. 2020;48(2):996–1009. doi: 10.1093/nar/gkz1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhu Y., Li Y., Xu Y., Zhang J., Ma L., Qi Q., Wang Q. Development of bifunctional biosensors for sensing and dynamic control of glycolysis flux in metabolic engineering. Metab Eng. 2021;68:142–151. doi: 10.1016/j.ymben.2021.09.011. [DOI] [PubMed] [Google Scholar]
- 37.Binder S., Schendzielorz G., Stabler N., Krumbach K., Hoffmann K., Bott M., Eggeling L. A high-throughput approach to identify genomic variants of bacterial metabolite producers at the single-cell level. Genome Biol. 2012;13(5) doi: 10.1186/gb-2012-13-5-r40. ARTNR4010.1186/gb-2012-13-5-r40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Baares A.B., Valdehuesa K.N.G., Ramos K.R.M., Nisola G.M., Lee W.K., Chung W.J. A pH-responsive genetic sensor for the dynamic regulation of D-xylonic acid accumulation in Escherichia coli. Appl Microbiol Biotechnol. 2020;104(5):2097–2108. doi: 10.1007/s00253-019-10297-0. [DOI] [PubMed] [Google Scholar]
- 39.Wang X., Han J.N., Zhang X., Ma Y.Y., Lin Y.N., Wang H., Li D.J., Zheng T.R., Wu F.Q., Ye J.W., Chen G.Q. Reversible thermal regulation for bifunctional dynamic control of gene expression in Escherichia coli. Nat Commun. 2021;12(1) doi: 10.1038/s41467-021-21654-x. 10.1038/s41467-021-21654-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Bertrand C., Benhamed M., Li Y.F., Ayadi M., Lemonnier G., Renou J.P., Delarue M., Zhou D.X. Arabidopsis HAF2 gene encoding TATA-binding protein (TBP)-associated factor TAF1, is required to integrate light signals to regulate gene expression and growth. J Biol Chem. 2005;280(2):1465–1473. doi: 10.1074/jbc.M409000200. [DOI] [PubMed] [Google Scholar]
- 41.Yukl E.T., Elbaz M.A., Nakano M.M., Moenne-Loccoz P. Transcription factor NsrR from Bacillus subtilis senses nitric oxide with a 4Fe-4S cluster (dagger) Biochemistry. 2008;47(49):13084–13092. doi: 10.1021/bi801342x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kommineni S., Yukl E., Hayashi T., Delepine J., Geng H., Moenne-Loccoz P., Nakano M.M. Nitric oxide-sensitive and -insensitive interaction of Bacillus subtilis NsrR with a ResDE-controlled promoter. Mol Microbiol. 2010;78(5):1280–1293. doi: 10.1111/j.1365-2958.2010.07407.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ding H.D., Bruce Direct nitric oxide signal transduction via nitrosylation of iron-sulfur centers in the SoxR transcription activator. Proc. P Natl Acad Sci USA. 2000;97(10):5146–5150. doi: 10.1073/pnas.97.10.5146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Xu K.D., Tong Y., Li Y., Tao J., Rao S.Q., Li J.H., Zhou J.W., Liu S. Efficient, flexible autoinduction expression systems with broad initiation in Bacillus subtilis. ACS Synth Biol. 2021;10(11):3084–3093. doi: 10.1021/acssynbio.1c00369. [DOI] [PubMed] [Google Scholar]
- 45.Swem L.R., Swem D.L., O'Loughlin C.T., Gatmaitan R., Zhao B.X., Ulrich S.M., Bassler B.L. A quorum-sensing antagonist targets both membrane-bound and cytoplasmic receptors and controls bacterial Pathogenicity. Mol Cell. 2009;35(2):143–153. doi: 10.1016/j.molcel.2009.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Tian X., Ding H., Ke W., Wang L. Quorum sensing in fungal species. Annu Rev Microbiol. 2021;75:449–469. doi: 10.1146/annurev-micro-060321-045510. [DOI] [PubMed] [Google Scholar]
- 47.He H., Li Y., Zhang L., Ding Z., Shi G. Understanding and application of Bacillus nitrogen regulation: a synthetic biology perspective. J Adv Res. 2022 doi: 10.1016/j.jare.2022.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Chen Y., Li B., Xu X., Zhang Z., Tian S. The pH-responsive PacC transcription factor plays pivotal roles in virulence and patulin biosynthesis in Penicillium expansum. Environ Microbiol. 2018;20(11):4063–4078. doi: 10.1111/1462-2920.14453. [DOI] [PubMed] [Google Scholar]
- 49.Penalva M.A., Tilburn J., Bignell E., Arst H.N., Jr. Ambient pH gene regulation in fungi: making connections. Trends Microbiol. 2008;16(6):291–300. doi: 10.1016/j.tim.2008.03.006. [DOI] [PubMed] [Google Scholar]
- 50.Zhang N., Wang Y., Wang Z., Yue Z., Niu Y. Heat shock transcription factor family in plants: a review. Chin J Biotechnol. 2021;37(4):1155–1167. doi: 10.13345/j.cjb.200367. [DOI] [PubMed] [Google Scholar]
- 51.Xiao F., Li Y., Zhang Y., Wang H., Zhang L., Ding Z., Gu Z., Xu S., Shi G. A new CcpA binding site plays a bidirectional role in carbon catabolism in Bacillus licheniformis. Isci. 2021;24(5) doi: 10.1016/j.isci.2021.102400. 10.1016/j.isci.2021.102400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Schumacher M.A., Chinnam N.B., Cuthbert B., Tonthat N.K., Whitfill T. Structures of regulatory machinery reveal novel molecular mechanisms controlling B. subtilis nitrogen homeostasis. Genes Dev. 2015;29(4):451–464. doi: 10.1101/gad.254714.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Charlier D., Weyens G., Roovers M., Piette J., Bocquet C., Piérard A., Glansdorff N. Molecular interactions in the control region of the carAB operon encoding Escherichia coli carbamoylphosphate synthetase. J Mol Biol. 1988;204(4):867–877. doi: 10.1016/0022-2836(88)90047-2. [DOI] [PubMed] [Google Scholar]
- 54.He B., Zalkin H. Repression of escherichia-coli Purb is by a transcriptional roadblock mechanism. J Bacteriol. 1992;174(22):7121–7127. doi: 10.1128/jb.174.22.7121-7127.1992. DOI10.1128/jb.174.22.7121-7127.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Swint-Kruse L., Matthews K.S. Allostery in the LacI/GalR family: variations on a theme. Curr Opin Microbiol. 2009;12(2):129–137. doi: 10.1016/j.mib.2009.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Valentin-Hansen P., Sogaard-Andersen L., Pedersen H. A flexible partnership: the CytR anti-activator and the cAMP-CRP activator protein, comrades in transcription control. Mol Microbiol. 1996;20(3):461–466. doi: 10.1046/j.1365-2958.1996.5341056.x. [DOI] [PubMed] [Google Scholar]
- 57.Nguyen Le Minh P., Velazquez Ruiz C., Vandermeeren S., Abwoyo P., Bervoets I., Charlier D. Differential protein-DNA contacts for activation and repression by ArgP, a LysR-type (LTTR) transcriptional regulator in Escherichia coli. Microbiol Res. 2018;206:141–158. doi: 10.1016/j.micres.2017.10.009. [DOI] [PubMed] [Google Scholar]
- 58.Shi J., Li F.F., Wen A.J., Yu L.B., Wang L., Wang F.L., Jin Y.L., Jin S., Feng Y., Lin W. Structural basis of transcription activation by the global regulator Spx. Nucleic Acids Res. 2021;49(18):10756–10769. doi: 10.1093/nar/gkab790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Cha S., Hong C.P., Kang H.A., Hahn J.S. Differential activation mechanisms of two isoforms of Gcr1 transcription factor generated from spliced and un-spliced transcripts in Saccharomyces cerevisiae. Nucleic Acids Res. 2021;49(2) doi: 10.1093/nar/gkaa1221. 10.1093/nar/gkaa1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Gaudinier A., Tang M., Bagman A.-M., Brady S.M. Identification of protein-DNA interactions using enhanced yeast one-hybrid assays and a semiautomated approach. Methods Mol Biol. 2017;1610:187–215. doi: 10.1007/978-1-4939-7003-2_13. [DOI] [PubMed] [Google Scholar]
- 61.Ota K., Feng S.-Y., Ito T. Detecting protein-DNA interactions using a modified yeast one-hybrid system. Methods Mol Biol. 2014;1164:39–50. doi: 10.1007/978-1-4939-0805-9_5. [DOI] [PubMed] [Google Scholar]
- 62.James P., Halladay J., Craig E.A. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics. 1996;144(4):1425–1436. doi: 10.1093/genetics/144.4.1425. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Deng C., Lv X.Q., Li J.H., Zhang H.Z., Liu Y.F., Du G.C., Amaro R.L., Liu L. Synergistic improvement of N-acetylglucosamine production by engineering transcription factors and balancing redox cofactors. Metab Eng. 2021;67:330–346. doi: 10.1016/j.ymben.2021.07.012. [DOI] [PubMed] [Google Scholar]
- 64.Li P.S., Fu X.F., Zhang L., Zhang Z.Y., Li J.H., Li S.Z. The transcription factors Hsf1 and Msn2 of thermotolerant Kluyveromyces marxianus promote cell growth and ethanol fermentation of Saccharomyces cerevisiae at high temperatures. Biotechnol Biofuels. 2017;10 doi: 10.1186/s13068-017-0984-9. ARTN28910.1186/s13068-017-0984-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Weinmann A.S. Novel ChIP-based strategies to uncover transcription factor target genes in the immune system. Nat Rev Immunol. 2004;4(5):381–386. doi: 10.1038/nri1353. [DOI] [PubMed] [Google Scholar]
- 66.Chen C.Y., Tsai H.K., Hsu C.M., Chen M.J.M., Hung H.G., Huang G.T.W., Li W.H. Discovering gapped binding sites of yeast transcription factors. P Natl Acad Sci USA. 2008;105(7):2527–2532. doi: 10.1073/pnas.0712188105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Harbison C.T., et al. Transcriptional regulatory code of a eukaryotic genome. Nature. 2004;431(7004):99–104. doi: 10.1038/nature02800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Oh S.W., Mukhopadhyay A., Dixit B.L., Raha T., Green M.R., Tissenbaum H.A. Identification of direct DAF-16 targets controlling longevity, metabolism and diapause by chromatin immunoprecipitation. Nat Genet. 2006;38(2):251–257. doi: 10.1038/ng1723. [DOI] [PubMed] [Google Scholar]
- 69.Wu J., Jin Y.Y., Gong R.L., Yang F., Su X.Y., Chen T.X. Genome-wide ChIP-seq and RNA-seq analyses of STAT3 target genes in TLRs activated human Peripheral blood B cells. Front Immunol. 2022;13 doi: 10.3389/fimmu.2022.821457. ARTN82145710.3389/fimmu.2022.821457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Skene P.J., Henikoff S. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife. 2017;6 doi: 10.7554/eLife.21856. ARTNe2185610.7554/eLife.21856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.van Steensel B., Henikoff S. Identification of in vivo DNA targets of chromatin proteins using tethered Dam methyltransferase. Nat Biotechnol. 2000;18(4):424–428. doi: 10.1038/74487. Doi10.1038/74487. [DOI] [PubMed] [Google Scholar]
- 72.Gallagher L.A., et al. Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Nat Microbiol. 2022;7(6):844. doi: 10.1038/s41564-022-01133-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Wang H.Y., Heinz M.E., Crosby S.D., Johnston M., Mitra R.D. 'Calling Cards' method for high-throughput identification of targets of yeast DNA-binding proteins. Nat Protoc. 2008;3(10):1569–1577. doi: 10.1038/nprot.2008.148. [DOI] [PubMed] [Google Scholar]
- 74.Xiao F.X., Li Y.R., Zhang Y.P., Wang H.R., Zhang L., Ding Z.Y., Gu Z.H., Xu S., Shi G.Y. Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis. Appl Microbiol Biotechnol. 2020;104(12):5409–5425. doi: 10.1007/s00253-020-10618-8. [DOI] [PubMed] [Google Scholar]
- 75.Hauf K., Kayumov A., Gloge F., Forchhammer K. The molecular basis of TnrA control by glutamine synthetase in Bacillus subtilis. J Biol Chem. 2016;291(7):3483–3495. doi: 10.1074/jbc.M115.680991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Geertz M., Maerkl S.J. Experimental strategies for studying transcription factor-DNA binding specificities. Brief Funct Genomics. 2010;9(5–6):362–373. doi: 10.1093/bfgp/elq023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Lambert S.A., Jolma A., Campitelli L.F., Das P.K., Yin Y., Albu M., Chen X., Taipale J., Hughes T.R., Weirauch M.T. The human transcription factors. Cell. 2018;172(4):650–665. doi: 10.1016/j.cell.2018.01.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Pang Z.P., Yang N., Vierbuchen T., Ostermeier A., Fuentes D.R., Yang T.Q., Citri A., Sebastiano V., Marro S., Sudhof T.C., Wernig M. Induction of human neuronal cells by defined transcription factors. Nature. 2011;476(7359):220–223. doi: 10.1038/nature10202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Zhang Y., Pak C., Han Y., Ahlenius H., Zhang Z., Chanda S., Marro S., Patzke C., Acuna C., Covy J., Xu W., Yang N., Danko T., Chen L., Wernig M., Sudhof T.C. Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron. 2013;78(5):785–798. doi: 10.1016/j.neuron.2013.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Takahashi K., Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126(4):663–676. doi: 10.1016/j.cell.2006.07.024. [DOI] [PubMed] [Google Scholar]
- 81.Jung S., Appleton E., Ali M., Church G.M., Del Sol A. A computer-guided design tool to increase the efficiency of cellular conversions. Nat Commun. 2021;12(1):1659. doi: 10.1038/s41467-021-21801-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Rackham O.J.L., Firas J., Fang H., Oates M.E., Holmes M.L., Knaupp A.S., Suzuki H., Nefzger C.M., Daub C.O., Shin J.W., Petretto E., Forrest A.R.R., Hayashizaki Y., Polo J.M., Gough J., Consortium F. A predictive computational framework for direct reprogramming between human cell types. Nat Genet. 2016;48(3):331–335. doi: 10.1038/ng.3487. [DOI] [PubMed] [Google Scholar]
- 83.Ng A.H.M., et al. A comprehensive library of human transcription factors for cell fate engineering. Nat Biotechnol. 2021;39(4):510–519. doi: 10.1038/s41587-020-0742-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Parekh U., Wu Y., Zhao D., Worlikar A., Shah N., Zhang K., Mali P. Mapping cellular reprogramming via Pooled overexpression screens with paired fitness and single-cell RNA-sequencing readout. Cell Syst. 2018;7(5):548–555 e8. doi: 10.1016/j.cels.2018.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Stadhouders R., Filion G.J., Graf T. Transcription factors and 3D genome conformation in cell-fate decisions. Nature. 2019;569(7756):345–354. doi: 10.1038/s41586-019-1182-7. [DOI] [PubMed] [Google Scholar]
- 86.Henley M.J., Koehler A.N. Advances in targeting 'undruggable' transcription factors with small molecules. Nat Rev Drug Discov. 2021;20(9):669–688. doi: 10.1038/s41573-021-00199-0. [DOI] [PubMed] [Google Scholar]
- 87.Sanda T., Lawton L.N., Barrasa M.I., Fan Z.P., Kohlhammer H., Gutierrez A., Ma W., Tatarek J., Ahn Y., Kelliher M.A., Jamieson C.H., Staudt L.M., Young R.A., Look A.T. Core transcriptional regulatory circuit controlled by the TAL1 complex in human T cell acute lymphoblastic leukemia. Cancer Cell. 2012;22(2):209–221. doi: 10.1016/j.ccr.2012.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Sikorski K., Czerwoniec A., Bujnicki J.M., Wesoly J., Bluyssen H.A.R. STAT1 as a novel therapeutical target in pro-atherogenic signal integration of IFN gamma, TLR4 and IL-6 in vascular disease. Cytokine Growth Factor Rev. 2011;22(4):211–219. doi: 10.1016/j.cytogfr.2011.06.003. [DOI] [PubMed] [Google Scholar]
- 89.Ji N.N., Sosa R.A., Forsthuber T.G. More than just a T-box: the role of T-bet as a possible biomarker and therapeutic target in autoimmune diseases. Immunotherapy-Uk. 2011;3(3):435–441. doi: 10.2217/Imt.10.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Mitchell S.M.S., Frayling T.M. The role of transcription factors in maturity-onset diabetes of the young. Mol Genet Metabol. 2002;77(1–2):35–43. doi: 10.1016/s1096-7192(02)00150-6. PiiS1096-7192(02)00150-6, Doi 10.1016/S1096-7192(02)00150-6. [DOI] [PubMed] [Google Scholar]
- 91.Hennezel E., Ben-Shoshan M., Ochs H.D., Torgerson T.R., Russell L.J., Lejtenyi C., Noya F.J., Jabado N., Mazer B., Piccirillo C.A. FOXP3 forkhead domain mutation and regulatory T cells in the IPEX syndrome. N Engl J Med. 2009;361(17):1710–1713. doi: 10.1056/NEJMc0907093. DOI10.1056/NEJMc0907093. [DOI] [PubMed] [Google Scholar]
- 92.Lee T.I., Young R.A. Transcriptional regulation and its misregulation in disease. Cell. 2013;152(6):1237–1251. doi: 10.1016/j.cell.2013.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Bushweller J.H. Targeting transcription factors in cancer - from undruggable to reality. Nat Rev Cancer. 2019;19(11):611–624. doi: 10.1038/s41568-019-0196-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Tran C., Ouk S., Clegg N.J., Chen Y., Watson P.A., Arora V., Wongvipat J., Smith-Jones P.M., Yoo D., Kwon A., Wasielewska T., Welsbie D., Chen C.D., Higano C.S., Beer T.M., Hung D.T., Scher H.I., Jung M.E., Sawyers C.L. Development of a second-Generation antiandrogen for treatment of advanced prostate cancer. Science. 2009;324(5928):787–790. doi: 10.1126/science.1168175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Nagaraj N., Wisniewski J.R., Geiger T., Cox J., Kircher M., Kelso J., Paabo S., Mann M. Deep proteome and transcriptome mapping of a human cancer cell line. Mol Syst Biol. 2011;7 doi: 10.1038/msb.2011.81. ARTN54810.1038/msb.2011.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Zhang H.Z., Qin Z.Y., Yue X.T., Liu Y., Sun X.G., Feng J.W., Xu Z.Y., Zhao J.Y., Li K., Qiu J.G., Yang W.J., He F.C., Ding C. Proteome-wide profiling of transcriptional machinery on accessible chromatin with biotinylated transposons. Sci Adv. 2021;7(43) doi: 10.1126/sciadv.abh1022. ARTNeabh102210.1126/sciadv.abh1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Zhou Q., Liu M.W., Xia X., Gong T.Q., Feng J.W., Liu W.L., Liu Y., Zhen B., Wang Y., Ding C., Qin J. A mouse tissue transcription factor atlas. Nat Commun. 2017;8 doi: 10.1038/ncomms15089. ARTN1508910.1038/ncomms15089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Yu W.W., Jin K., Wu Y.K., Zhang Q.W., Liu Y.F., Li J.H., Du G.C., Chen J., Lv X.Q., Ledesma-Amaro R., Liu L. A pathway independent multi-modular ordered control system based on thermosensors and CRISPRi improves bioproduction in Bacillus subtilis. Nucleic Acids Res. 2022;50(11):6587–6600. doi: 10.1093/nar/gkac476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Kim S.G., Noh M.H., Lim H.G., Jang S., Jang S., Koffas M.A.G., Jung G.Y. Molecular parts and genetic circuits for metabolic engineering of microorganisms. FEMS Microbiol Lett. 2018;365(17) doi: 10.1093/femsle/fny187. ARTNfny18710.1093/femsle/fny187. [DOI] [PubMed] [Google Scholar]
- 100.Qiu X., Xu P., Zhao X., Du G., Li J. Metab Eng; 2020. Combining genetically-encoded biosensors with high throughput strain screening to maximize erythritol production in Yarrowia lipolytica; p. 60. [DOI] [PubMed] [Google Scholar]
- 101.Han L.C., Liu X.Y., Cheng Z.Y., Cui W.J., Guo J.L., Yin J., Zhou Z.M. Construction and application of a high-throughput in vivo screening platform for the evolution of nitrile metabolism-related enzymes based on a Desensitized repressive biosensor. ACS Synth Biol. 2022;11(4):1577–1587. doi: 10.1021/acssynbio.1c00642. [DOI] [PubMed] [Google Scholar]
- 102.Tian R., Liu Y., Chen J., Li J., Liu L., Du G., Chen J. Synthetic N-terminal coding sequences for fine-tuning gene expression and metabolic engineering in Bacillus subtilis. Metab Eng. 2019;55:131–141. doi: 10.1016/j.ymben.2019.07.001. [DOI] [PubMed] [Google Scholar]
- 103.Ding N.N., Yuan Z.Q., Zhang X.J., Chen J., Zhou S.H., Deng Y. Programmable cross-ribosome-binding sites to fine-tune the dynamic range of transcription factor-based biosensor. Nucleic Acids Res. 2020;48(18):10602–10613. doi: 10.1093/nar/gkaa786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Zhao E.M., Zhang Y.F., Mehl J., Park H., Lalwani M.A., Toettcher J.E., Avalos J.L. Optogenetic regulation of engineered cellular metabolism for microbial chemical production. Nature. 2018;555(7698):683. doi: 10.1038/nature26141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Aramaki H., Yagi N., Suzuki M. Residues important for the function of a multihelical DNA binding domain in the new transcription factor family of Cam and Tet repressors. Protein Eng. 1995;8(12):1259–1266. doi: 10.1093/protein/8.12.1259. DOI10.1093/protein/8.12.1259. [DOI] [PubMed] [Google Scholar]
- 106.Li M., Gu R.Y., Su C.C., Routh M.D., Harris K.C., Jewell E.S., McDermott G., Yu E.W. Crystal structure of the transcriptional regulator AcrR from Escherichia coli. J Mol Biol. 2007;374(3):591–603. doi: 10.1016/j.jmb.2007.09.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Jain D. Allosteric control of transcription in GntR family of transcription regulators: a structural overview. IUBMB Life. 2015;67(7):556–563. doi: 10.1002/iub.1401. [DOI] [PubMed] [Google Scholar]
- 108.Maddocks S.E., Oyston P.C.F. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiol SEM. 2008;154:3609–3623. doi: 10.1099/mic.0.2008/022772-0. [DOI] [PubMed] [Google Scholar]
- 109.Cortes-Avalos D., Martinez-Perez N., Ortiz-Moncada M.A., Juarez-Gonzalez A., Banos-Vargas A.A., Estrada-de Los Santos P., Perez-Rueda E., Ibarra J.A. An update of the unceasingly growing and diverse AraC/XylS family of transcriptional activators. FEMS Microbiol Rev. 2021;45(5) doi: 10.1093/femsre/fuab020. ARTNfuab02010.1093/femsre/fuab020. [DOI] [PubMed] [Google Scholar]
- 110.Yang J., Tauschek M., Robins-Browne R.M. Control of bacterial virulence by AraC-like regulators that respond to chemical signals. Trends Microbiol. 2011;19(3):128–135. doi: 10.1016/j.tim.2010.12.001. [DOI] [PubMed] [Google Scholar]
- 111.Brown N.L., Stoyanov J.V., Kidd S.P., Hobman J.L. The MerR family of transcriptional regulators. FEMS Microbiol Rev. 2003;27(2–3):145–163. doi: 10.1016/S0168-6445(03)00051-2. [DOI] [PubMed] [Google Scholar]
- 112.Gorodetsky A.A., Dietrich L.E.P., Lee P.E., Demple B., Newman D.K., Barton J.K. DNA binding shifts the redox potential of the transcription factor SoxR. P Natl Acad Sci USA. 2008;105(10):3684–3689. doi: 10.1073/pnas.0800093105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 113.Ramos J.L., Martinez-Bueno M., Molina-Henares A.J., Teran W., Watanabe K., Zhang X.D., Gallegos M.T., Brennan R., Tobes R. The TetR family of transcriptional repressors. Microbiol Mol Biol Rev. 2005;69(2):326. doi: 10.1128/Mmbr.69.2.326-356.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 114.Youn H., Carranza M. cAMP activation of the cAMP receptor protein, a model bacterial transcription factor. J Microbiol. 2023;61(3):277–287. doi: 10.1007/s12275-023-00028-6. [DOI] [PubMed] [Google Scholar]
- 115.Zhang Q., Liu W., Zhang H.M., Xie G.Y., Miao Y.R., Xia M.X., Guo A.Y., hTFtarget A comprehensive database for regulations of human transcription factors and their targets. Dev Reprod Biol. 2020;18(2):120–128. doi: 10.1016/j.gpb.2019.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116.Jin J., Tian F., Yang D.C., Meng Y.Q., Kong L., Luo J., Gao G. PlantTFDB 4.0: toward a central hub for transcription factors and regulatory interactions in plants. Nucleic Acids Res. 2017;45(D1):D1040–D1045. doi: 10.1093/nar/gkw982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 117.Chow C.N., Lee T.Y., Hung Y.C., Li G.Z., Tseng K.C., Liu Y.H., Kuo P.L., Zheng H.Q., Chang W.C. PlantPAN3.0: a new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Res. 2019;47(D1):D1155–D1163. doi: 10.1093/nar/gky1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Kanamori M., Konno H., Osato N., Kawai J., Hayashizaki Y., Suzuki H. A genome-wide and nonredundant mouse transcription factor database. Biochem Biophys Res Commun. 2004;322(3):787–793. doi: 10.1016/j.bbrc.2004.07.179. [DOI] [PubMed] [Google Scholar]
- 119.Mao Z.T., Wang R.Y., Li H.R., Huang Y.X., Zhang Q., Liao X.P., et al. ERMer: a serverless platform for navigating, analyzing, and visualizing Escherichia coli regulatory landscape through graph database. Nucleic Acids Res. 2022;50(1):298–304. doi: 10.1093/nar/gkac288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120.Hu H., Miao Y.R., Jia L.H., Yu Q.Y., Zhang Q., Guo A.Y. AnimalTFDB 3.0: a comprehensive resource for annotation and prediction of animal transcription factors. Nucleic Acids Res. 2019;47(D1):D33–D38. doi: 10.1093/nar/gky822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Mathelier A., Fornes O., Arenillas D.J., Chen C.Y., Denay G., Lee J., Shi W., Shyr C., Tan G., Worsley-Hunt R., Zhang A.W., Parcy F., Lenhard B., Sandelin A., Wasserman W.W. Jaspar 2016: a major expansion and update of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2016;44(D1):D110–D115. doi: 10.1093/nar/gkv1176. [DOI] [PMC free article] [PubMed] [Google Scholar]









