Thai traditional massage modulates urinary MCP-1 and relevant inflammatory biomarkers in lower urinary tract symptom patients

Abstract

Lower urinary tract symptoms (LUTS) resulting from benign prostatic hyperplasia are a common complaint among elderly men worldwide. Our previous study reported alleviative efficacy of Thai traditional massage (TTM) on LUTS patients. However, underlying mechanism at cellular level remained elusive. Herein, we investigated the effect of TTM on urinary monocyte chemotactic protein-1 (MCP-1) and associative inflammatory biomarkers. Forty-three patients were randomized into two groups: Tamsulosin (n = 23) and TTM (n = 20). The urinary MCP-1 and interferon-gamma (IFN-γ) levels as well as gene expression levels of MCP-1, Chemotactic protein receptor 2b (CCR2b), IFN-γ, interleukin-1 beta (IL-1β), and transforming growth factor-beta 1 (TGF-β1) were evaluated before and after a four-week treatment. The urinary MCP-1 and IFN-γ levels as well as gene expression levels of MCP-1, CCR2b, IFN-γ, IL-1β, and TGF-β1 were evaluated before and after treatment with Tamsulosin or TTM group. Urinary MCP-1 and IFN-γ levels and the expression levels of five genes from sedimented urine samples were measured using Enzyme-Linked Immunosorbent Assay and quantitative Reverse Transcription Polymerase Chain Reaction, respectively. We observed significant (p < 0.05) reduction in the ratio of urinary MCP-1 and creatinine (Cr); MCP-1/Cr levels in subjects given only TTM. There were no significant differences (p < 0.05) in IFN-γ/Cr levels in both groups. TTM group down-regulated the expression of IFN-γ whereas up-regulated IL-1β and TGF-β1 mRNA. Our findings suggested TTM had alleviative effects in LUTS patients, which were partially mediated by a reduction of urinary inflammatory cytokines and inflammatory gene expression.

Graphical abstract

1. Introduction

Benign prostatic hyperplasia (BPH) is a widespread male disease that affects millions of men due to its causal role in lower urinary tract symptoms (LUTS) and is becoming more common as people age. Increasing LUTS and the occurrence of urine retention are associated to a considerable increase in mortality risks. A two-component hypothesis is proposed to be the causative agents or factors contributing to LUTS/BPH, which bulk growth (hyperplasia and hypertrophy) and adrenergically-driven smooth muscle tone. However, the presence of a third element, regarding inflammatory process, has been hypothesized. Epidemiological has shown global incidence of BPH was 11.27 million (95% Uncertainty Interval: 8.79 to 14.46) and increased by 105.70% from 1990 to 2019. South Asia, East Asia, Eastern Europe, Southeast Asia, and Western Europe were the top five regions with incidents of BPH.¹ It is well established prostatic inflammation is a major factor in prostate enlargement and BPH development.² Despite several biomarkers such as interleukin-8, monocyte chemotactic protein-1 (MCP-1), c-c chemokine receptor 7, cytotoxic T lymphocyte-associated antigen 4, inducible T-cell co-stimulator, and CD40 ligand were clinically used to predict the disease, tissue biopsy is still the gold standard for histologically evaluating prostatic inflammation.³

Regarding disease pathogenesis, the inflammatory response is characterized by T-lymphocyte infiltration, activation, and upregulation of proinflammatory cytokines as well as increased expression of stromal and epithelial growth factors following abnormal prostate cell proliferation.² It has been reported a positive correlation between chronic inflammation and LUTS related to BPH.⁴

Urinary biomarkers produced by prostatic epithelial and stromal cells (PrSC) and prostatic epithelial cells (PrEC) could be altered in several conditions influencing bladder activity.^{5, 6, 7, 8, 9} To date, the alteration of urinary protein markers and their associated cytokines in LUTS as a consequence of prostatic inflammation remain unknown.

Monocyte chemoattractant protein-1/C–C motif chemokine ligand 2 (MCP-1/CCL2) is a major chemokine that regulates monocyte/macrophage migration and infiltration. Monocyte Chemotactic Protein receptor 2 (CCR2) is a chemokine receptor of MCP-1/CCL2 and mediates its effects via the CCR2 receptor. It is indeed vital to note that CCR2 has a dual role, acting in both pro-inflammatory and anti-inflammatory activities.¹⁰ Several studies showed that MCP-1 was found to be released by PrSC and to activate PrEC for proliferative process. The inflammatory cytokines, namely interleukin-1 beta (IL-1β), interferon-γ (IFN-γ), and interleukin-2 (IL-2) also induced increased MCP-1 production from PrSC. Furthermore, MCP-1 levels in PrEC were also associated with macrophage marker CD68 mRNA levels in the same secretions.¹¹ MCP-1 has recently been a novel potential biomarker for symptomatic BPH. In post-digital rectal examination (DRE), it was found higher urinary MCP-1 levels were associated with increased IPSS (severe symptoms) but not with prostate volume.¹² Furthermore, MCP-1/creatinine (Cr) as urinary biomarkers of inflammation and tissue remodeling for prediction of bladder dysfunction in BPH was also associated with the presence of detrusor overactivity in the urodynamic study.⁵

In line with urinary inflammatory biomarkers, it was found that IFN-γ, transforming growth factor β (TGF-β) and IL-1β play important roles in both acute and chronic inflammation in patient presented with LUTS.¹³ In physiological condition, IFN-γ is an important cytokine in the host defense against infection. The level of IFN-γ was normally associated with the pathogenesis of chronic inflammatory and autoimmune diseases.¹⁴ Specifically, in chronic inflammatory response, IFN-γ plays a crucial role in attenuating tissue destruction.¹⁵ The IFN-γ activates Macrophage type 1 (M1) polarization, resulting in macrophage hyper-responsiveness to various inflammatory stimuli for Toll-like receptors. This stimulation results in a massive super-induction of inflammatory cytokines and canonical nuclear factor-κB target genes. Thereafter, IFN-γ activates gene-specific refractoriness to anti-inflammatory factors, for example, IL-10, glucocorticoids, and IL-4 and IL-1. These cytokines would promote the resolution of inflammation and tissue healing, thereby returning to homeostasis. Moreover, IFN-γ could prevent and reverse macrophage tolerance.¹⁶ Also, it induces nitric oxide production and inhibits nucleotide-binding domain and leucine-rich repeat-containing protein-3 inflammasome activation.¹⁷ Ex vivo studies show that the IFN-γ gene is expressed in a similar level between prostate cancer (PCa) and BPH. IFN-γ gene expression was detected in 78% of PCa and 63% of BPH tissues. However, the level of IFN-γ gene expression in BPH specimens was significantly higher than in PCa specimens.¹³ Additionally, IFN-γ, IL-2, and IL-4 mRNA could be found in both BPH and normal prostate. It was found that IL-2, IL-7, and IFN-γ can stimulate BPH-PrSC cell line proliferation but not that of normal PrSC, whereas IL-4 exerts inhibitory effect on BPH-PrSC growth.¹⁸ As for TGF-β, it is important for wound healing, angiogenesis, immunoregulation, and cancer. The cells of the immune system produce the TGF-β1 isoform, which exerts powerful anti-inflammatory functions, and is thought to be a master regulator of the immune response.¹⁹ The other cytokine, IL-1β is a prototypical proinflammatory cytokine exerting pleiotrophic effects on a wide range of cells and its function is involved in acute and chronic inflammatory and autoimmune diseases. Overproduction of IL-1β has been linked to the pathophysiological changes seen in rheumatoid arthritis, neuropathic pain, inflammatory bowel disease, osteoarthritis, vascular disease, multiple sclerosis, and Alzheimer's disease.²⁰

Thai traditional massage (TTM) has been practiced for thousands of years composing of three distinct signatures including deep pressure massage, manipulation on meridian (energy) lines, and stretching of the damaged muscles and joints. TTMs are commonly employed in health care,^{21, 22, 23, 24} rehabilitation,^23,24 and other fields. However, no scientific evidence has been reported regarding underlying mechanism. Although our previous study indicated TTM could be used as an alternative treatment for LUTS patients by improving their International Prostate Symptom Score (IPSS) score as compared to Tamsulosin, the effect of TTM on urinary inflammatory biomarkers as well as associated-inflammatory gene expression have not been elucidated.²⁵ The present study, therefore, aimed to investigate the potential effects of TTM on urinary MCP-1 and IFN-γ biomarkers and associated gene expression including MCP-1, CCR2b, IFN-γ, IL-1β, and TGF-β1 as well as LUTS symptoms.

2. Materials and methods

2.1. Trial design

A prospective non-inferiority randomized clinical trial study has been approved by the Human Research Ethical Committee No.1 of the Faculty of Medicine, Thammasat University, before data collection (MTU-EC–OO–4-068/61). The study was registered with the Thai Clinical Trial Registry (No. TCTR20190204001). The study was carried out from December 2018 to December 2020. Participants were recruited at the out-patient department of surgery (Urology department), Thammasat University Hospital and massage treatment was given at Chulabhorn International College of Medicine, Pathum Thani, Thailand. All urine samples after DRE were collected from participants who met the following inclusion criteria 1) male patients suffering from LUTS for at least 6 months; 2) age 50–75 years old; 3) moderate level of symptoms (IPSS score between 8 -19); 4) urinary peak flow rate is between 5 -15 mL/s evaluated by uroflowmetry with post-voided volume of ≥150 mL determined by bladder scan; 5) Prostate-specific antigen (PSA) level is ≤ 4 ng/mL; 6) blood urine nitrogen (BUN) level is 10–20 mg/dL; 7) creatinine level (Cr) is 0.7–1.3 mg/dL; and 8) glomerular filtration rate (GFR) is > 60 mL/min. The exclusion criteria were 1) urethral stricture and/or bladder neck disease active or recent <3 months; 2) recurrent urinary tract infection, urinary retention, indication of BPH surgery or prostate surgery; 3) bladder/urethra stone; 4) acute or chronic prostatitis, prostate or bladder cancer, interstitial cystitis; 5) active upper tract stone disease-causing symptoms, indication of bladder neck and pelvic region surgery; 6) local or systemic inflammation disorder; 7) orthostatic hypotension (standing systolic blood pressure reduced >20 mmHg or diastolic blood pressure reduced >10 mmHg compared to supine); 8) history of neurologic or psychiatric disorder or disease interfering with the detrusor or sphincter muscle, insulin-dependent, and non-controlled non-insulin-dependent diabetes mellitus; and 9) history of chronic renal insufficiency and history of severe hepatic failure or other severe underlying diseases.

2.2. Treatment

After the informed consent was obtained, 58 eligible participants were randomly assigned to the control (n = 29) and study (n = 29) groups using the block of four randomization technique. The control group was prescribed 0.4 mg of Tamsulosin orally before bedtime every day, while the study group received 30 min of TTM twice a week for four weeks. The TTM method was described previously.²⁵ Briefly, TTM was performed on the abdominal muscle, which consisted of three pairs of points and one line. The duration of each massage point was 15 s and was repeated three times.

After DRE evaluation, 30 mL of urine samples were collected at the pre-(baseline) and post-(4 weeks) of treatment. The samples were centrifuged at 15,000×g for 30 min at 4 °C. Subsequently, the supernatant and sedimented samples were collected and immediately stored at −80 °C until further analyses. The urinary inflammatory biomarkers (supernatant fraction) and gene expression sedimented fraction) were determined by Enzyme-Linked Immunosorbent Assay (ELISA) and quantitative Reverse Transcription PCR (qRT-PCR), respectively.¹² A flow chart of the study protocol is presented in Fig. 1.

Fig. 1.

Flow chart protocol of the study.

2.3. ELISA

The levels of urine biomarkers were analyzed by using sandwich ELISA obtained from commercial ELISA kits (MCP-1 from R&D Systems, Minneapolis, MN, USA; IFN-γ and IL-10 from BioLegend-San Diego, CA, USA; Cr from Cell BioLabs, USA). ELISA was performed on absorbance microplate reader (Thermo scientific, USA) as manufacturer's instructions. The sensitivity of MCP-1 and IFN-γ assays in pg/mL were 0.57–10.0 and 4, respectively. All assays were performed in duplicate and the values of cytokine were normalized to the creatinine concentration and expressed in the relative ration to Cr.

2.4. qRT-PCR

Total RNA was extracted from sedimented samples, according to the manufacturer's protocol. The quality and quantity of the extracted RNA were measured by Denovix DS-11 spectrophotometer (DeNovix, USA). RNA was then reverse-transcribed into cDNA using RevertAid First Strand cDNA Synthesis (Invitrogen, USA). The qRT-PCR was conducted in a CFX96 real-time PCR machine (BioRad, USA) using Maxima SYBR Green qPCR Master Mix (Thermo Scientific, USA), as described by the manufacturer's instruction. Briefly, in a 10 μL reaction volume, the following components were added: 3 μL of 3x diluted cDNA, 5 μL of 2x Maxima SYBR Green qPCR Master Mix, 0.2 μM of each primer, and 1.6 μL RNase-free water. The sequences of primers were shown in Table 1. The PCR cycle consisted pre-denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 20 s, 57 °C for 20 s, and 72 °C for 30 s. To verify the amplification product, the melting curve analysis was 95 °C-5 s, 65 °C-5 s, and 95 °C-5 s. As a reference mRNA control, the housekeeping gene GAPDH was used, and the relative expression was calculated using the 2 ^-ΔΔCT method.²⁶

Table 1.

Primers used in this study.

Gene	Primer sequences (5´→ 3′)	Size (bp)	Accession number/ Reference
MCP-1	F: CTCGCCTCCAGCATGAAAGT	111	NM_002982.4
	R: GGTGACTGGGGCATTGATTG
CCR2b	F: GAGACTCTTGGGATGACTCAC	213	Fujita et al., 2010
	R: TTATAAACCAGCCGAGACTTC
INF-γ	F: ACTGACTTGAATGTCCAACGC	150	NM_000619.3
	R: TTGCAGGCAGGACAACCATT
IL-1β	F: CCTGAGCTCGCCAGTGAAAT	150	NM_000576.3
	R: GTCGGAGATTCGTAGCTGGA
TGF-β1	F: TGAGCCGTGGAGGGGAAAT	100	NM_000660.7
	R: GTAGTGAACCCGTTGATGTCCA
GAPDH	F: GAAAGCCTGCCGGTGACTAA	120	NM_001256799.3
	R: AGGAAAAGCATCACCCGGAG

2.5. Statistical analysis

Statistical analysis was performed by GraphPad Prism 9.0.0 (GraphPad Software Inc., San Diego, CA, USA). All results were analyzed for normality by the Kolmogorov–Smirnov test. The urinary MCP-1/Cr and IFN-γ levels are presented as mean ± standard deviation and compared within groups by the one-sample Wilcoxon test. The expressions of MCP-1, CCR2b, INF-γ, TGF-β1 and IL1β genes were analyzed by an unpaired t-test for parametric and Wilcoxon test for non-parametric within a group. The comparison between groups at the same time of evaluation were analyzed by Mann Whitney test. The correlation was analyzed by Spearman's test. A value of p < 0.05 was considered significant.

3. Results

3.1. Baseline of patient characteristics

The baseline characteristics of patient in this study are similar to that of our previous study (Sinsomboon et al., 2022).²⁵ Detail of age, PSA, BUN, Cr, and GFR levels were listed. The age of control and case were 63.20 ± 7.11 and 62.55 ± 7.06, respectively. The PSA level of all participants was <4 ng/mL, while BUN and Cr were <15 and 1.3 mg/dL, respectively. Both groups showed GFR >60 mL/min.

3.2. The urinary indicator cytokines

To investigate the key LUTS-severity indicators, urinary MCP-1/Cr, IFN-γ/Cr and IL-10/Cr levels were measured before and after treatment. As shown in Table 2, MCP-1/Cr levels were statistically decreased only in the TTM group after 4-weeks of intervention (p = 0.016), while the IFN-γ/Cr levels were increased in both groups without statistically significant difference. Additionally, scattered data from individual participant's urinary MCP-1/Cr and IFN-γ/Cr levels were also investigated. The result revealed that each value is closely similar in both groups (Fig. 2A–B). However, the level of IL-10 in urine could not be detected (data not shown). Therefore, our results suggested that the TTM exerted a similar effect to Tamsulosin as a standard medication.

Table 2.

The urinary MCP-1/Cr and IFN-γ/Cr levels of LUTS patients after TTM intervention as compared to Tamsulosin group.

MCP-1/Cr (x ${10}^{-2}$ ng/ml)	Baseline (Mean ± SD)	End of Study (Mean ± SD)	p-value
Tamsulosin group	1.407 ± 2.255	1.416 ± 2.638	0.678
TTM group	6.064 ± 11.92	0.769 ± 1.820	0.016∗
IFN-γ/Cr (x ${10}^{-2}$ ng/ml)
Tamsulosin group	0.092 ± 0.212	0.391 ± 1.311	0.250
TTM group	0.034 ± 0.147	0.074 ± 0.165	0.475

∗ Wilcoxson test, p < 0.05.

Fig. 2.

The individual levels of MCP-1/Cr (A) and IFN-γ/Cr (B) in both groups at baseline and after treatment for 4 weeks. TB and TE represent Tamsulosin at baseline (B) and the end of the study (E). MB and ME represent TTM at B and E.

Next, we investigated the relationship between the changing in urinary MCP-1/Cr level and the IPSS score between baseline and the end of the study. As shown in Fig. 3, both treatments display a tendency correlation between the urinary MCP-1/Cr level and the IPSS score (Tamsulosin; r = −0.261, p = 0.228, (Fig. 3A), and TTM; r = −0.314, p = 0.574, (Fig. 3B), suggesting improvement in LUTS symptoms was related to the efficacy of the medication and TTM mediated by urinary biomarkers. Furthermore, percentage changes of MCP-1/Cr in IFN-γ/Cr of both interventions were also investigated. The results showed a significant positive correlation in the Tamsulosin group (r = 0.422, p = 0.032) (Fig. 4A). After 4-week given TTM, the reduction of urinary IFN-γ/Cr had a slightly negative correlation with urinary MCP-1/Cr (r = −0.057, p = 0.811) (Fig. 4B).

Fig. 3.

The correlation between the change of IPSS score and urinary MCP-1/Cr of Tamsulosin (A) and TTM (B) groups.

Fig. 4.

The correlation between the percentage changes of urinary MCP-1 and the urinary IFN-γ in the Tamsulosin (A) and TTM (B) groups.

3.3. mRNA expression levels of MCP-1, CCR2b, IFN-γ, TGF-β1 and IL-1β

To determine the underlying mechanism of attenuated effects of TTM on LUTS symptoms whether is mediated by mRNA expression levels of urinary inflammatory markers, MCP-1, CCR2b, and other associated genes. The expression of mRNA was evaluated before and after both treatments. The results showed that MCP-1 expression was downregulated in the Tamsulosin group but slightly decreased in the TTM intervention. However, the post-treatment levels of MCP-1 showed no statistical difference between the two groups (p = 0.146) (Fig. 5A). Although CCR2b expression was downregulated after intervention by TTM and Tamsulosin, there was no statistically significant as compared to individual baseline (Fig. 5B). Altogether, our data indicates that TTM could downregulate the expression of both MCP-1 and CCR2b genes in a similar action to Tamsulosin.

Fig. 5.

The relative mRNA expression levels of MCP-1 (A), CCR2b (B), IFN-γ (C), IL-1β (D), and TGF-β1 (E) were determined by qRT-PCR. Data were expressed as mean ± SEM. Significant differences (p < 0.05) are indicated by ∗. TB and TE represent Tamsulosin at baseline (B) and the end of the study (E). MB and ME represent TTM at B and E.

As for the other three associated genes, including IFN-γ, TGF-β1 and IL-1β, the results illustrated that the relative mRNA expression level of IFN-γ after intervention was slightly higher in the Tamsulosin group but lower in the TTM intervention (Fig. 5C). The relative mRNA expression levels of IL-1β and TGF-β1 were downregulated after treatment of the Tamsulosin group, however, it trended to upregulate in the TTM (Fig. 5D and E). Interestingly, the IL-1β gene in TTM was significantly higher than Tamsulosin at the end of the study (Fig. 5D). These data suggest that TTM can alter the expression levels of MCP-1, CCR2b, and three associated-inflammatory genes, indicating that its efficacy is comparable to Tamsulosin.

4. Discussion

Although our previous study indicated TTM could be used as an alternative treatment for LUTS patients by improving their International Prostate Symptom Score (IPSS), underlying mechanism have not been elucidated. In the present study, we demonstrated that TTM could reduce the ratio of urinary MCP-1 levels (MCP-1/Cr), which is a novel biomarker for clinically inflammatory BPH. In addition, alleviative effect of TMM was comparable to an alpha-blocker medication, Tamsulosin.

Urinary MCP-1/Cr has been identified as a biomarker of LUTS improvement in BPH. The reduction in urinary MCP-1/Cr after TTM intervention suggests TTM has a similar action to Tamsulosin, which is consistent with the study Fujita et al.¹¹ They reported that urinary MCP-1 level was associated with IPSS (r = 0.376, p = 0.022) but not with prostate volume (r = 0.190, p = 0.194). Moreover, urinary MCP-1 level was also correlated with serum PSA (r = 0.190, p = 0.194). When the analysis was based on disease severity representing by IPSS score, it was shown that urinary MCP-1 levels were highest in IPSS scores between 8 and 19, indicating moderate symptoms of LUTS secondary to BPH.¹¹ Moreover, MCP-1/Cr levels were significantly higher in preoperative DO patients with BPH in the study of de Conti PS et al.⁵ Regarding an inflammatory biomarker, MCP-1 was found to be positively correlated with the white blood cell count of expressed prostatic secretion (r = 0.44, p = 0.003) and also correlated with the chronic prostatitis symptom index.²⁷ Previous investigation reported that urinary IFN-γ is a mediator, which is predominantly secreted from the prostatic epithelial cells and could stimulate the release of MCP-1.¹¹ Thus, the reduction of urinary MCP-1 could be a result of a decrease in IFN-γ. After the TTM session, the urinary MCP-1/IFN-γ was decreased in relation to the urinary MCP-1 reduction indicating positive effect of TTM on LUTS/BPH improvement.

Analysis of MCP-1, CCR2b, IFN-γ, IL-1β, and TGF-β1 gene expression confirmed the molecular action of TTM by lowering MCP-1, CCR2b, and IFN-γ mRNA levels. TTM may reduce IFN-γ, which in turn reduces MCP-1 and CCR2b expression. Several studies suggest that MCP-1 secretion from stromal and epithelial cells could theoretically be induced by IFN-γ and IL-1β, thereby promoting epithelial cell development via a stromal–epithelial or autocrine connection. Elevated MCP-1 levels in the prostate may potentially attract more inflammatory cells, contributing to a positive feedback loop that promotes BPH.²⁸ Prior research has shown that the number of MCP-1 mRNA-expressing cells in prostate cancer was significantly lower than in benign prostatic hyperplasia.²⁹ Our study demonstrated that TGF-β1 and IL-1β expression were increased after the TTM session. It was reported in literature that elevation of TGF-β1 expression could induce a fibroplasia stromal response, which is associated with breach of epithelial wall structure and inflammatory involvement of nerve ganglia and vessels.³⁰ Moreover, TGF-β1 can induce apoptosis or inhibit proliferation of non-transformed cells, but it loses its growth-inhibitory potential as cells progress to later stages of tumorigenesis.³¹ Our result suggests that increasing TGF-β1 gene expression after TTM sessions may result in cell apoptosis, thereby alleviating LUTS symptoms.

CCR2b chemokine receptor mediates monocyte migrate from the bone marrow under the influence of chemokine CCL2. It affects macrophage polarization by granulocyte-macrophage colony-stimulating factor and macrophage-colony-stimulating factor.³² Our finding revealed that TTM could downregulate the CCR2b gene, which was similar to the action of Tamsulosin implying TTM exerts its activity on macrophage polarization.³²

Up until now, there is no evidence that shows TTM modulates immune responses in LUTS patients. In an experimental autoimmune prostatitis mouse, intravenous infusion of IL-1β would prime mesenchymal stromal cells resulting in reduced inflammation in prostate tissues and relieved hyperalgesia.²⁷ Infused mesenchymal stromal cells reduced monocyte infiltration and stimulated the development of regulatory T lymphocytes in prostate tissue, as well as changing the inflamed local environment.³¹ Therefore, the elevation of IL-1β mRNA expression after the TTM session may involve changing the inflamed local environment.

Our findings clearly demonstrated that TTM could reduce IFN-γ whereas increasing TGF-β1 and IL-1β genes. Therefore, the molecular mechanism of TTM on immune responses and the inflammatory process for LUTS symptoms has been proposed in Fig. 6. Previous study reported that in an inflammatory microenvironment, Th cells differentiate into Th cells of the Th1 pathway from a naïve T cell (Th0). This Th1 cell becomes a strong pro-inflammatory, which impact on macrophage development, leading to an infiltration of M1 macrophages. M1 macrophage thus release IL-6 and TNF-γ into the microenvironment resulting in perpetuating the cycle.³³ Due to the features of mechanotransduction, massage may allow a modification of environment. In the event of phenotypic change from an M1 to an M2 macrophage, anti-inflammatory cytokines such as IL-4, TGF-β, and IL-10 influence local dendritic cells to alter Th0 differentiation to the Th2 pathway via IL-4 and IL-13. Th2 cells can then boost macrophage development, resulting in an excess of the M2 anti-inflammatory phenotype and signaling the start of the repair and regeneration phase.³³ The decrease in IFN-γ after massage may result in transition of Th0 polarization to Th2 as well as adjust cellular proliferation and apoptosis.³⁴ The function of Th2 is to activate macrophage type 2, alter the prostate microenvironment, and release TGF-β. It could change the microenvironment into an anti-inflammatory process. The TGF-β1 is a master regulator of the immune response, exerting powerful anti-inflammatory functions.¹⁷ The study of Tyagi P et al. reported relative abundance of TGF-β1 in urine with concomitant absence in serum for IFN-γ, IL-1β, suggesting interconnection of prostate and urine.³⁵ It was known that T helper cells (Th) play an important role in the activation or suppression of different immune system components depending on cytokine secretion. Th1 cells support immunity against tumors and infection via cytokines such as IFN-γ, TNF-α, and IL-2 whereas Th2 cells are the producers of IL-4, IL-5, IL-6, and IL-10 as well as could support the humeral immune response.

Fig. 6.

The proposed mechanism of action of TTM in LUTS modulates immune responses. Increased IFN-γ production in prostatic epithelial cells (PrEC) and IL-1β and TGF-β1 in prostatic stromal cells (PrSC), resulting in MCP-1 release in BPH patient prostate tissues. MCP-1 activates cell proliferation and causes LUTS. TTM has the ability to downregulate both MCP-1 and CCR2b but upregulate IFN-γ, implying immune homeostasis after massage intervention. In aspect of immune responses, a decrease in IFN-γ after massage may cause a shift from Th0 to Th2 polarization. Th2 will then activate macrophage type 2, alter the prostate microenvironment, and release TGF-β.

With regard to the immunity in massage, several studies suggest that massage therapy can significant increase in natural killer cell number, natural killer cell activity as well as the number of CD4⁺ in adolescent and adults with human immunodeficiency virus infection.³⁶ In a breast cancer patient, massage therapy could increase Th1 activity over the course of a moderate massage session. It also alter the Th1/Th2 balance, which result in a decrease production of pro-inflammatory cytokines, IL-4, IL-5, IL-6, and IL-10.³⁷ Moreover, previous studies have revealed massage could increase a number of natural killer cells and lymphocytes in breast cancer patient.^{36, 37, 38} Study by Yameng Xu et al.³⁹ reported that pushing the three passes and rubbing the abdomen clockwise can increases the Immunoglobulin A and G, and CD4⁺/CD8⁺ concentration in children with diarrhea.³⁹ Recently, a report from Sornkayasit K et al. suggested that TTM could attenuate the senescent CD4⁺ T cell subsets, especially in CD4⁺28null NKG2D⁺ T cells.⁴⁰

5. Conclusion

In conclusion, the present study demonstrates that TTM for 15 s of each point for three pairs of points and one line, twice a week for 4 weeks has beneficial effects in LUTS by downregulation of MCP-1 and CCR2b genes expression, contributing to reducing urinary MCP-1/Cr level. In a similar to Tamsulosin efficacy, TTM could be useful in alleviating LUTS resulting from BPH. However, further investigation is required to demonstrate other cellular and molecular mechanisms by which TTM reduces LUTS.

Author's contributions

OS performed the experiments, analyzed the data, and initially wrote the manuscripts. NK and AN analyzed the data, reviewed and edited the manuscript. KS conceived of the clinical investigation and reviewed the manuscript. SS conceived the idea, designed the study, wrote and finalized the manuscript, including resources, funding acquisition, and project administration.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations

LUTS

Lower Urinary Tract Symptoms

BPH

Benign prostatic Hyperplasia

TTM

Thai traditional massage

MCP-1

Monocyte Chemotactic Protein-1

CCR2b

Monocyte Chemotactic Protein receptor 2b

IFN-γ

Interferon-gamma

IL-1β

Interleukin-1beta

TGF-β1

Transforming Growth Factor -Beta1

ELISA

Enzyme-Linked Immunosorbent Assay

qRT-PCR

Quantitative Reverse Transcription Polymerase Chain Reaction

IPSS

International Prostate Symptoms Score

MCP-1/Cr

Monocyte Chemotactic Protein-1 normalized by Creatinine

IFN-γ

Interferon-gamma normalized by Creatinine

mRNA

Messenger Ribonucleic Acid

LUTS/BPH

Lower Urinary Tract Symptoms secondary to Benign prostatic Hyperplasia

PrSC

Prostatic Stromal cells

PrEC

Prostatic Epithelial cells

MCP-1/CCL2

Monocyte Chemotactic Protein-1/C–C motif chemokine ligand 2

CCR2

C–C chemokine receptor 2

IL-2

Interleukin-2

DRE

digital rectal examination

DO

Detrusor Overactivity

TGF-β

Transforming Growth Factor

M1

Macrophage 1

IL-10

Interleukin-10

IL-4

Interleukin-4

IL-13

Interleukin-13

PCa

Prostate cancer

IL-7

Interleukin-7

BPH-PSC

Benign Prostatic Hyperplasia- Prostatic Stromal Cells

PSA

Prostate Specific Antigen

BUN

Blood urine nitrogen

Cr

Creatinine

GFR

Glomerular filtration rate

RNA

Ribonucleic Acid

cDNA

Complementary Deoxyribonucleic Acid

qPCR

Quantitative polymerase chain reaction

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

Th1

T helper cells-1

Th0

Naïve T cell

TNF-α

Tumor Necrosis Factor-alpha

M2

Macrophage 2

Th2

T helper cells-2

IL-5

Interleukin-5

IL-6

Interleukin-6