Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
DNA sequencing results
| Isolate | DNA sequencea |
|---|---|
| wtb | ctgtctcagtttatggaccagaacaacccgctgtctgagattacgcacaaacgtcgtatctccgcactc |
| RM6 | cCgtctcagtttatggaccagaacaacccgctgtctgagattacgcacaaacgtcgtatctccgcactc |
| RM10 | cCgtctcagtttatggaccagaacaacccgctgtctgagattacgcacaaacgtcgtatctccgcactc |
From codon 511 to 533. An uppercase letter denotes a base change.
wt, rifampin-sensitive wild-type isolate sequence.
