REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-mouse CD3e (145-2C11) BV510	BioLegend	Cat#100353; RRID: AB_2565879
Anti-mouse CD4 (GK1.5) PerCP/Cy5.5	BioLegend	Cat#100434; RRID: AB_893324
Anti-mouse CD8a (53-6.7) Alexa Fluor700	BioLegend	Cat#100730; RRID: AB_493703
Anti-mouse/human CD11b (M1/70) PE-Cy7	BioLegend	Cat#101216; RRID: AB_312799
Anti-mouse CD19 (6D5) Alexa Fluor700	BioLegend	Cat#115528; RRID: AB_493735
Anti-mouse CD25 (PC61) PE	BioLegend	Cat#102008; RRID: AB_312857
Anti-mouse CD25 (PC61) BV510	BioLegend	Cat#102042; RRID: AB_2562270
Anti-mouse/human CD44 (IM7) PerCP/Cy5.5	BioLegend	Cat#103032; RRID: AB_2076204
Anti-mouse/human CD44 (IM7) BV605	BioLegend	Cat#103047; RRID: AB_2562451
Anti-mouse CD62L (MEL-14) BV421	BioLegend	Cat#104436; RRID: AB_2562560
Anti-mouse CD127 (SB/199) biotin	BioLegend	Cat#121104; RRID: AB_493502
Anti-mouse F4/80 (BM8) BV785	BioLegend	Cat#123141; RRID: AB_2563667
Anti-mouse FceR1 (MAR-1) Alexa Fluor700	BioLegend	Cat#134324; RRID: AB_2566734
Anti-mouse/human IL-5 (TRFK5) APC	BioLegend	Cat#504306; RRID: AB_315330
Anti-mouse IFN-γ (XMG1.2) BV785	BioLegend	Cat#505838; RRID: AB_2629667
Anti-mouse Arginase 1 (A1exF5) PE	eBioscience	Cat#12-3697-82; RRID: AB_2734839
Anti-mouse CD3 (17A2) Alexa Fluor700	eBioscience	Cat#56-0032-82; RRID: AB_529507
Anti-mouse CD4 (GK1.5) ef450	eBioscience	Cat#48-0041-82; RRID: AB_10718983
Anti-mouse CD4 (GK1.5) Alexa Fluor700	eBioscience	Cat#56-0041-82; RRID: AB_493999
Anti-mouse CD4 (GK1.5) FITC	eBioscience	Cat#11-0041-82; RRID: AB_464892
Anti-mouse CD8a (53-6.7) PE-Cy5	eBioscience	Cat#15-0081-82; RRID: AB_468706
Anti-mouse CD11b (M1/70) Alexa Fluor700	eBioscience	Cat#56-0112-82; RRID: AB_657585
Anti-mouse CD11c (N418) Alexa Fluor700	eBioscience	Cat#56-0114-82; RRID: AB_493992
Anti-mouse/human CD44 (IM7) APC	eBioscience	Cat#17-0441-82; RRID: AB_469390
Anti-mouse CD45.1 (A20) PE-Cy5	eBioscience	Cat#15-0453-82; RRID: AB_468759
Anti-mouse CD45.2 (104) Alexa Fluor700	eBioscience	Cat#56-0454-82; RRID: AB_657752
Anti-mouse/human Gata-3 (TWAJ) eFluor660	eBioscience	Cat#50-9966-42; RRID: AB_10596663
Anti-mouse GR-1/Ly-6G/C (RB6-8C5) Alexa Fluor700	eBioscience	Cat#56-5931-82; RRID: AB_494007
Anti-mouse IL-13 (eBio13A) PE	eBioscience	Cat#12-7133-82; RRID: AB_763559
Anti-mouse IL-13 (eBio13A) PE-Cy7	eBioscience	Cat#25-7133-82; RRID: AB_2573530
Anti-mouse Ki67 (SolA15) PE-Cy7	eBioscience	Cat#25-5698-82; RRID: AB_11220070
Anti-mouse KLRG1 (2F1) PerCP-eFluor710	eBioscience	Cat#46-5893-82; RRID: AB_10670282
Anti-mouse Ly-6G (1A8-Ly6G) PerCP-eFluor710	eBioscience	Cat#46-9668-82; RRID: AB_2573893
Anti-mouse MHCII (M5/114.15.2) eFluor450	eBioscience	Cat#48-5321-82; RRID: AB_1272204
Anti-mouse NK1.1 (PK136) Alexa Fluor700	eBioscience	Cat#56-5941-82; RRID: AB_2574505
Anti-mouse TCR beta (H57-597) eFluor450	eBioscience	Cat#48-5961-82; RRID: AB_11039532
Anti-mouse TER-119 (TER-119) Alexa Fluor700	eBioscience	Cat#56-5921-82; RRID: AB_2815252
Fixable Viability Dye eFluor 780	eBioscience	Cat#65-0865-18
Anti-mouse CD45 (30-F11) BUV395	BD Biosciences	Cat#564279; RRID: AB_2651134
Anti-mouse NK1.1 (PK136) BUV395	BD Biosciences	Cat#564144; RRID: AB_2738618
Anti-mouse SiglecF (E50-2440) Alexa Fluor647	BD Biosciences	Cat#562680; RRID: AB_2687570
Streptavidin BUV737	BD Biosciences	Cat#612775; RRID: AB_2870104
Anti-mouse ST2 (DJ8) FITC	MD bioproducts	Cat#101001F; RRID: AB_947549
2W1S-tetramer PE	NIH Tetramer Facility	N/A
anti-ADNP	Novus Biologicals	Cat#NBP1-89236; RRID: AB_11008573
anti-CTCF	Cell Signaling	Cat#2899; RRID: AB_2086794
anti-GATA3	Cell Signaling	Cat#5852; RRID: AB_10835690
anti-CHD4	Cell Signaling	Cat#12011; RRID: AB_2734702
anti-JUNB	Cell Signaling	Cat#3753; RRID: AB_2130002
anti-H3K27ac	Cell Signaling	Cat#8173; RRID: AB_10949503
anti-BRG1	abcam	Cat#ab110641; RRID: AB_10861578
anti-BATF	abcam	Cat#ab236876;
anti-HP1g	abcam	Cat#ab217999; RRID: AB_217999
anti-p300	abcam	Cat#ab275378
anti-CD3	2B Scientific	Cat#Ab00105-1.1
anti-CD28	2B Scientific	Cat#AGEL0759
anti-IFNg	2B Scientific	Cat#AGEL2200
anti-IL-4	BioLegend	Cat#504101
Chemicals, peptides, and recombinant proteins
2W1S peptide	Designer Bioscience	N/A
papain	Sigma-Aldrich	Cat#76216
rmIL-2, carrier-free	Biolegend	Cat#575406
rmIL-4, carrier-free	Biolegend	Cat#574306
rmIL-12, carrier-free	Biolegend	Cat#577006
PMSF	Sigma Aldrich	Cat#P7626
collagenase I	Gibco	Cat#17100017
DNase I, from bovine pancreas	Sigma-Aldrich	Cat#D5025/DN25
Percoll	GE Healthcare	Cat#17-0891-01
cOmplete protease inhibitor	Roche	Cat#4693116001
Pierce 660nm protein assay reagent	ThermoFisher,	Cat#22660
A/G dynabeads)	Thermo Scientific	Cat#88802
1X NuPage LDS sample buffer	Invitrogen	Cat#NP0008
ECL western blotting detection reagent	GE Healthcare	Cat#RPN2106
protein A Dynabeads	ThermoFisher	Cat#10002D
NAP	Biotechne	Cat#6779
Critical commercial assays
Mouse IgE Uncoated ELISA kit	Invitrogen	Cat#88-504460-88
Ovation RNA-seq System V2	Tecan	Cat#7102-32
Ovation Ultralow Library Systems	Tecan	Cat#0344NB-32
Fixable Dye eFluor 780	Invitrogen	Cat#65-0865-14
BD Cytofix/Cytoperm Plus reagents	BD Biosciences	Cat#555028
Protein Transport Inhibitor Cocktail	eBioscience	Cat#00-4980-9
Gibson assembly	New England BioLabs	Cat#E5510S
NEB T4 DNA ligase	New England BioLabs	Cat#M0202S
RPMI 1640 + GlutaMAX	GIBCO	Cat#61870-010
Fetal Calf Serum	GIBCO	Cat#10270-106
2-mercaptoethanol	Sigma-Aldrich	Cat#M6250
DMEM	GIBCO	Cat#10564011
Fugene HD Transfection Reagent	Promega	Cat#E2311
OPTI-MEM	GIBCO	Cat#31985062
DNeasy Blood & Tissue Kits	QIAGEN	Cat#69504
Herculase II Fusion DNA polymerase	Agilent	Cat#600675
KAPA library quantification kit	Roche	Cat#KK4824
RNeasy Plus Micro kit	Qiagen	Cat#74034
truChIP Chromatin Shearing kit	Covaris	Cat#520154
Foxp3 Staining kit reagents	eBioscience	Cat#00-5523-00
Qiagen MinElute kit	Qiagen	Cat#28004
Kappa HiFi HotStart Ready mix	Roche	Cat#KK2601
Illumina Tagment DNA Enzyme and Buffer	Illumina	Cat#20034197
SPRI Ampure XP beads	Beckman Coulter	Cat#A63881
Deposited data
scRNAseq	This paper	GEO: GSE218017
ATACseq	This paper	GEO: GSE218017
ChIPseq	This paper	GEO: GSE218017
Experimental models: Cell lines
Platinum-E retroviral packaging cells	Cell biolabs	Ca#RV-101
Experimental models: Organisms/strains
Mouse: Rosa26Cas9EGFP	The Jackson Laboratory	JAX 026179
Mouse: Il13tdTom	Barlow et al.38	N/A
Mouse: Il7rCre	Schlenner et al.63	MGI:4441349
Mouse: CD4Cre	Taconic	Ca#4196
Mouse: Adnptm1a(KOMP)Wtsi	KOMP repository	RRID:MMRRC_051854-UCD
Mouse: C57BL/6JOla	Jackson Labs (Bred in LMB)	Cat#000664; RRID: IMSR_JAX:000664
Oligonucleotides
Primer for sgRNA-insert amplification (Forward) AATGGACTATCATATG CTTACCGTAACTTGAAAGTATTTCG	Sigma-Aldrich	N/A
Primer for sgRNA-insert amplification (Reverse) CTTTAGTTTGTATGTCTGTT GCTATTATGTCTACTATTCTTTCC	Sigma-Aldrich	N/A
Software and algorithms
FlowJo	FlowJo, LLC	RRID: SCR_008520
Prism 9	GraphPad Prism	RRID: SCR_002798
Cutadapt	N/A	https://journal.embnet.org/index.php/embnetjournal/article/view/200
Trim Galore	Babraham Bioinformatics	https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/
DESeq2	Love et al.64	https://bioconductor.org/packages/release/bioc/vignettes/DESeq2/inst/doc/DESeq2.html
10x Cell Ranger	10x Genomics	https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/installation
10x Genomics Loupe Browser	10x Genomics	https://www.10xgenomics.com/products/loupe-browser
Scaffold programme (Proteome Software Inc., USA)65	Keller et al.65	Proteome Software Inc., USA
Bowtie2 (version 2.3.5.1)	Langmead et al.66	https://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
HOMER	Heinz et al.67	http://homer.ucsd.edu/homer/index.html
SeqMonk software (v1.48.0)	Babraham Bioinformatics	https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/
FACSDiva software	BD Biosciences	https://www.bdbiosciences.com/en-gb/products/software/instrument-software/bd-facsdiva-software
Macs2 (v2.1.2)	Zhang et al.68	https://github.com/macs3-project/MACS/wiki
STAR (version 2.6.0a)	N/A	https://github.com/alexdobin/STAR
Other
Mouse Brie CRISPR knockout pooled library	Addgene	Ca#73633
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP	Addgene	Ca#86457