How Pol α-primase is targeted to replisomes to prime eukaryotic DNA replication

. 2023 Aug 17;83(16):2911–2924.e16. doi: 10.1016/j.molcel.2023.06.035

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains

E. coli 5-alpha Competent (High Efficiency)	New England Biolabs	Cat# C2987H
E. coli: Rosetta™ 2(DE3) strain: F^-ompT hsdS_B(r_B^- m_B^-) gal dcm (DE3) pRARE2 (Cam^R)	Novagen / Merck Millipore	Cat# 71400
E. coli DH10 EMBacY	Geneva Biotech	https://geneva-biotech.com/product_category/insect-cell-expression/multibac/

Chemicals, peptides, and recombinant proteins

3X FLAG peptide	Sigma	Cat# F4799
Adenosine 5’-(β,γ-imido)triphosphate lithium salt hydrate (AMP-PNP)	Sigma	Cat# A2647
dNTP set	Invitrogen	Cat# 10297018
NTP set	Invitrogen	Cat# R0481
[alpha-P32]dCTP	Hatmann analytic	Cat# SRP-205
Glutaraldehyde	Sigma	Cat# G5882
Nonidet P-40 substitute (NP-40-S)	Roche	Cat# 11754599001
Glutathione Sepharose 4B	GE Healthcare	Cat# 17-0756-01
Suberic acid bis(3-sulfo-N-hydroxysuccinimide ester) sodium salt (BS³)	Sigma	Cat# S5799
TWEEN® 20	Sigma	Cat# P8341
Biotin	Sigma	Cat# B4501
cOmplete™, Mini, EDTA-free protease inhibitor cocktail	Sigma	Cat# 11873580001
FuGENE® HD	Promega	Cat# E2311
Insect-XPRESS protein-free insect cell media with L-glutamine	Lonza	Cat# BELN12-730Q
Sf-900™ II serum-free media	GIBCO	Cat# 10902-088
SilverQuest™ staining kit	Invitrogen	Cat# LC6070
Bovine Serum Albumin	Invitrogen	Cat# AM2616
Phusion® High-Fidelity DNA Polymerase	New England Biolabs	Cat# E0553
SphI	New England Biolabs	Cat# R0182
SapI	New England Biolabs	Cat# R0569
FspI	New England Biolabs	Cat# R0135
BsaHI	New England Biolabs	Cat# R0556
β-Glucuronidase	Sigma	Cat# G7017
TEV protease	Nagai laboratory	N/A
Proteinase K	New England Biolabs	P8107

Recombinant proteins

(see also Table S2)
Budding yeast (S. cerevisiae)
Cdt1-Mcm2-7	Coster et al.⁶⁰	N/A
ORC	Frigola et al.⁶¹	N/A
Cdc6	Frigola et al.⁶¹	N/A
DDK	On et al.⁶²	N/A
Sld3/7	Yeeles et al.³⁸	N/A
Cdc45	Yeeles et al.³⁸	N/A
Dpb11	Yeeles et al.³⁸	N/A
Sld2	Yeeles et al.³⁸	N/A
GINS	Yeeles et al.³⁸	N/A
Pol ε	Yeeles et al.³⁸	N/A
S-CDK	Yeeles et al.³⁸	N/A
Mcm10	Yeeles et al.³⁸	N/A
Pol α	Yeeles et al.³⁸	N/A
Ctf4	Yeeles et al.³⁸	N/A
RPA	Baretić et al.³⁰	N/A
Mrc1	Baretić et al.³⁰	N/A
Tof1-Csm3	Baretić et al.³⁰	N/A
RFC	Yeeles et al.³⁷	N/A
PCNA	Yeeles et al.³⁷	N/A
Pol δ	Yeeles et al.³⁷	N/A
CMG	Baretić et al.³⁰	N/A
Cdt1-Mcm2-7: Mcm3-CR	This study	N/A
Pol α-primase: Pol1-4A	This study	N/A
Pol α-primase: Pol12ΔN	This study	N/A
Pol α-primase: Pol1-4A⋅Pol12ΔN	This study	N/A
Pol α-primase: Pri2-Δ2-8	This study	N/A
Pol α-primase: Pri2-5A	This study	N/A
Pol α-primase: Pri2-AAA	This study	N/A
Pol α-primase: Pol1-4A⋅Pri2-Δ2-8	This study	N/A
Pol α-primase: Pol1-4A⋅Pol12-ΔN⋅Pri2-Δ2-8	This study	N/A
Pol α-primase: Pol12-ΔN⋅Pri2-Δ2-8	This study	N/A

*Human (H. sapiens)*

CMG	Jones et al.⁴¹	N/A
CLASPIN	Jones et al.⁴¹	N/A
TIMELESS-TIPIN	Jones et al.⁴¹	N/A
AND-1	Jones et al.⁴¹	N/A
Pol ε	Jones et al.⁴¹	N/A
Pol α-primase	Baris et al.²⁷	N/A
PCNA	Jones et al.⁴¹	N/A
RPA	Jones et al.⁴¹	N/A
Ctf18-RFC	Baris et al.²⁷	N/A
Pol δ	Baris et al.²⁷	N/A
Pol α-primase: PRIM2-Δ2-7	This study	N/A
CMG: MCM3-4A	This study	N/A
AND1: ΔHMG (Δ1017)	Baris et al.²⁷	N/A

Deposited data

Budding yeast (S. cerevisiae)
Co-ordinate file for the Pol α-primase associated replisome in the absence of Ctf4	This study	8B9C
Co-ordinate file for the Pol α-primase associated replisome in the presence of Ctf4, CIP box site #1	This study	8B9A
Co-ordinate file for the Pol α-primase associated replisome in the presence of Ctf4, CIP box site #2	This study	8B9B
Pol α-primase associated replisome consensus refinement in the absence of Ctf4 (binned)	This study	EMD-16320
Pol α-primase associated replisome consensus refinement in the absence of Ctf4 (un-binned)	This study	EMD-16322
Tof1-Csm3 local refinement	This study	EMD-15304
Mcm2-7 C-tier local refinement	This study	EMD-15305
Pol12, Pol1CTD, Pri2NTD local refinement	This study	EMD-15306
Pol12, Pol1CTD local refinement	This study	EMD-16885
Pol α-primase associated replisome consensus refinement in the presence of Ctf4 (binned)	This study	EMD-15309
Pol α-primase associated replisome consensus refinement in the presence of Ctf4 (un-binned)	This study	EMD-15902
Ctf4 local refinement	This study	EMD-15310
Pri1, Pri2CTD local refinement	This study	EMD-16247
Pol α-primase associated replisome consensus refinement containing density for the Pol1exo/cat and Pri2CTD domains	This study	EMD-16248
Pol α-primase associated replisome consensus refinement containing density for the lagging strand DNA template and the Pri1CTD (binned)	This study	EMD-15924
Pol α-primase associated replisome consensus refinement containing density for the lagging strand DNA template and the Pri1CTD (un-binned)	This study	EMD-15303
Pol α-primase associated replisome consensus refinement where only the Pri2:Mcm5ZnF interface is engaged	This study	EMD-16323

*Human (H. sapiens)*

Co-ordinate file for the Pol α-primase associated replisome	This study	8B9D
Pol α-primase associated replisome consensus refinement (un-binned)	This study	EMD-15341
MCM2-7 C-tier local refinement	This study	EMD-15340
AND-1 local refinement	This study	EMD-15342
Pol α-primase associated replisome consensus refinement containing strong PRIM1 density (binned)	This study	EMD-15349
PRIM1, POLA2, PolA1CTD, Pri2NTD local refinement	This study	EMD-15351
TIMELESS-TIPIN local refinement	This study	EMD-15356
Composite map assembled from EMD-15342:15341:15340:15349:15351:15356	This study	EMD-15904
Pol α-primase associated replisome consensus refinement, not engaged on DNA derived from dataset including a 15 nucleotide 5ʹ-flap DNA fork	This study	EMD-15918
Pol α-primase associated replisome consensus refinement, not engaged on DNA derived from dataset including a 60 nucleotide 5ʹ-flap DNA fork	This study	EMD-15923
Pol α-primase associated replisome consensus refinement, engaged on a 15 nucleotide 5ʹ-flap DNA fork	This study	EMD-15922

Experimental Models: Cell Lines

Hi5	Thermo Fisher	B85502

Experimental models: Organisms/strains

S. cerevisiae strains (See also Table S3 for additional details of strains constructed as part of this study)
yAM33 (Cdt1-Mcm2-7 purification)	Coster et al.⁶⁰	N/A
ySDORC (ORC purification)	Frigola et al.⁶¹	N/A
ySDK8 (DDK purification)	On et al.⁶²	N/A
yTD6 (Sld3/7 purification)	Yeeles et al.³⁸	N/A
yTD8 (Sld2 purification)	Yeeles et al.³⁸	N/A
yJY13 (Cdc45 purification)	Yeeles et al.³⁸	N/A
yJY26 (Dpb11 purification)	Yeeles et al.³⁸	N/A
yAJ2 (Pol epsilon purification)	Yeeles et al.³⁸	N/A
yAE88 (S-CDK purification)	Jake et al.⁶³	N/A
yAE95 (Pol alpha purification)	Jake et al.⁶³	N/A
yAE40 (Ctf4 purification)	Yeeles et al.³⁸	N/A
yJY106 (RPA purification)	Baretić et al.³⁰	N/A
yJY32 (Mrc1 purification)	Yeeles et al.³⁷	N/A
yAE48 (Tof1-Csm3 purification)	Yeeles et al.³⁷	N/A
yAE41 (RFC purification)	Yeeles et al.³⁷	N/A
yAE34 (Pol delta purification)	Yeeles et al.³⁷	N/A
yJY197 (CMG purification)	Jenkyn-Bedford et al.⁴²	N/A
yVA87 (Cdt1-Mcm2-7: Mcm3-CR)	This study	N/A
yVA96 (Pol α-primase: Pol1-4A)	This study	N/A
yJY239 (Pol α-primase: Pol12-ΔN)	This study	N/A
yJY232 (Pol α-primase: Pri2-5A)	This study	N/A
yJY241 (Pol α-primase: Pri2-Δ2-8)	This study	N/A
yJY242 (Pol α-primase: Pri2-AAA)	This study	N/A
yJY381 (Pol α-primase: Pol1-4A⋅Pol12ΔN)	This study	N/A
yMJ12 (Pol α-primase: Pol1-4A⋅Pri2-Δ2-8)	This study	N/A
yMJ13 (Pol α-primase: Pol1-4A⋅Pol12-ΔN⋅Pri2-Δ2-8)	This study	N/A
yMJ18 (Pol α-primase: Pol12-ΔN⋅Pri2-Δ2-8)	This study	N/A
yJY244	This study	N/A
yJY297	This study	N/A
yJY321	This study	N/A
yJY300	This study	N/A
yJY301	This study	N/A
yJY365	This study	N/A
yJY367	This study	N/A
yJY345	This study	N/A
yJY350	This study	N/A
yJY351	This study	N/A
yJY356	This study	N/A
yJY357	This study	N/A
yJY255	This study	N/A
yJY302	This study	N/A
yJY326	This study	N/A
yJY328	This study	N/A
yJY313	This study	N/A
yJY315	This study	N/A
yJY317	This study	N/A
yJY352	This study	N/A
yJY354	This study	N/A

Oligonucleotides

Leading strand: 5ʹ-(Cy3)-TAGAGTAGGAAG TGAGGTAAGTGATTAGAGAATTGGAGAGT GTG(T)34T∗T∗T∗T∗T∗T – 3ʹ (∗ - phosphorothioate)	Integrated DNA Technologies (IDT)	N/A
15 Nucleotide 5ʹ-flap lagging strand: 5ʹ-GGCAGG CAGGCAGGCACACACTCTCCAATTCTCTAATCA CTTACCACACTTCCTACTCTA – 3ʹ	Integrated DNA Technologies (IDT)	N/A
60 nucleotide 5ʹ-flap lagging strand: (T)₆₀ACACAC TCTCCAATTCTCTAATCACTTACCATCACTTCCT ACTCTA – 3ʹ	Integrated DNA Technologies (IDT)	N/A
MT096: 5′phos/GCTATGTGGTAGGA AGTGAGAATTGGAGAGTGTGTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTGAGGAAAGAATGTTGGTG AGGGTTGGGAAGTGGAAGGATGG GCTCGAGAGGTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT	Integrated DNA Technologies (IDT)	N/A
JY197: 5′- TTTTTTTTTTTTTTTTTTTTCACA CTCTCCAATTCTCACTTCCTACCACAT	Integrated DNA Technologies (IDT)	N/A
JY195: 5′ - CCTCTCGAGCCCATC CTTCCACTTCCCAACCCTCACC	Integrated DNA Technologies (IDT)	N/A
JY104: 5′ - GAATTGCGCTCTATGAAGTTGAC	Merck	N/A
JY105: 5′ - GAACTGCGGCTTGATAATGG	Merck	N/A
JY370: 5′ - GGACTAGGATGAGTAGCAGC	Merck	N/A
JY491: 5′ - GAGTCAGACAACCAGCAAGC	Merck	N/A
JY604: 5′ - GGTTGAAGAGCAGGCCAAGG	Merck	N/A
JY609: 5′ - TCAGGCCAAAGGTGATACGAC	Merck	N/A
VA212: 5′ - GACCTGTCGAATTCTCTCAA	Merck	N/A

Recombinant DNA

vVA20	Aria and Yeeles¹	N/A
M13mp18 ssDNA	New England Biolabs	Cat# N4040S
ZN3	Taylor and Yeeles⁷	N/A
pJFDJ5 (yeast GINS purification)	Yeeles et al.³⁸	N/A
vJY19 (yeast PCNA purification)	Yeeles et al.³⁷	N/A
pAM3 (yeast Cdc6 purification)	Coster et al.⁶⁰	N/A
pET28a-Mcm10 (yeast Mcm10 purification)	Yeeles et al.³⁸	N/A
YB_X1 (human RPA purification)	This study	N/A
MT_EB1 (human PCNA purification)	Jones et al.⁴¹	N/A
YB_2 (human CMG purification)	Jones et al.⁴¹	N/A
YB_1 (human CMG purification)	Jones et al.⁴¹	N/A
MT_01 (human CMG purification)	Jones et al.⁴¹	N/A
MT_BF1 (AND-1 purification)	Jones et al.⁴¹	N/A
MT_DB1 (CLASPIN purification)	Jones et al.⁴¹	N/A
MT_DF1 (TIMELESS-TIPIN purification)	Jones et al.⁴¹	N/A
MT_BD1 (TIMELESS-TIPIN purification)	Jones et al.⁴¹	N/A
MT_BH1 (human RFC purification)	Jones et al.⁴¹	N/A
MT_BJ1 (human RFC purification)	Jones et al.⁴¹	N/A
MT_BK1 (human RFC purification)	Jones et al.⁴¹	N/A
MT_BL1 (human RFC purification)	Jones et al.⁴¹	N/A
MT_BI1 (human RFC purification)	Jones et al.⁴¹	N/A
YB_7 (CTF18-RFC purification)	Baris et al.²⁷	N/A
YB_5 (CTF18-RFC purification)	Baris et al.²⁷	N/A
YB_6 (CTF18-RFC purification)	Baris et al.²⁷	N/A
YB_4 (CTF18-RFC purification)	Baris et al.²⁷	N/A
MT_CF1 (human Pol delta purification)	Baris et al.²⁷	N/A
MT_CH1 (human Pol delta purification)	Baris et al.²⁷	N/A
YB_3 (human Pol delta purification)	Baris et al.²⁷	N/A
MT_FC1 (human Pol delta purification)	Baris et al.²⁷	N/A
MT_BC3 (human Pol alpha-primase purification)	Baris et al.²⁷	N/A
MT_AE1 (human Pol alpha-primase purification)	Baris et al.²⁷	N/A
MT_AF1 (human Pol alpha-primase purification)	Baris et al.²⁷	N/A
MT_AG1 (human Pol alpha-primase purification)	Baris et al.²⁷	N/A
MT_U2 (human Pol epsilon purification)	Baris et al.²⁷	N/A
MT_L1 (human Pol epsilon purification)	Baris et al.²⁷	N/A
MT_M1 (human Pol epsilon purification)	Baris et al.²⁷	N/A
MT_N1 (human Pol epsilon purification)	Baris et al.²⁷	N/A
YB_8 (AND-1-ΔHMG purification)	Baris et al.²⁷	N/A
YB_X2 (MCM3-4A construction)	This study	N/A
YB_X3 (CMG: MCM3-4A purification)	This study	N/A
vVA62 (CMG: MCM3-4A purification)	This study	N/A
vMJ9 (human Pol alpha-primase: PRIM2-Δ2-7)	This study	N/A
vVA52 (Cdt1-Mcm2-7: Mcm3-CR strain construction)	This study	N/A
vVA58 (yeast Pol alpha-primase: Pol1-4A strain construction)	This study	N/A
vJY186 (yeast Pol alpha-primase: Pol12-ΔN) strain construction)	This study	N/A
vJY187 (yeast Pol alpha-primase: Pol1-4A⋅Pol12-ΔN) strain construction)	This study	N/A
vJY196 (yeast Pol alpha-primase: Pri2-Δ2-8) strain construction)	This study	N/A
vJY183 (yeast Pol alpha-primase: Pri2-5A) strain construction)	This study	N/A
vJY199 (yeast Pol alpha-primase: Pri2-AAA strain construction)	This study	N/A
vJY177 (construction of Mcm3-CR (Ura3) strain)	This study	N/A
vJY206 (construction of Pri2-AAA (Ura3) strain)	This study	N/A

Software and algorithms

Chimera (v1.13)	UCSF Resource for Biocomputing, Visualization, and Informatics	https://www.cgl.ucsf.edu/chimera/
ChimeraX (v1.52)	UCSF Resource for Biocomputing, Visualization, and Informatics	https://www.cgl.ucsf.edu/chimerax/
Coot (v1.0)	Paul Emsley (Medical Research Council Laboratory of Molecular Biology)	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
EPU (v2.0)	ThermoFisher Scientific (FEI)	https://www.fei.com/software/epu-automated-single-particles-software-for-life-sciences
ESPript (v3.0.7)	Patrice Gouet (Lyon University); Xavier Robert (Centre national de la recherche scientifique)	http://espript.ibcp.fr/ESPript/ESPript/
FIJI (v1.0)	National Institute of Health	https://imagej.net/Fiji/Downloads
Gautomatch (v0.53)	Kai Zhang (Medical Research Council Laboratory of Molecular Biology)	https://www.mrc-lmb.cam.ac.uk/kzhang/Gautomatch/
ImageJ (v1.50i)	National Institute of Health	https://imagej.nih.gov/ij/
ISOLDE (v1.4)	Tristan Croll (Cambridge Institute for Medical Research)	https://isolde.cimr.cam.ac.uk/
Phenix (v1.20-4459)	Cambridge University; Duke University; Lawrence Berkeley National Laboratory; Los Alamos National Laboratory	https://www.phenix-online.org/
Photoshop 2020	Adobe	https://www.adobe.com/uk/products/photoshop.html
Prism (v9.0.0)	GraphPad	https://www.graphpad.com/scientific-software/prism/
RELION (v2.1 & v3.1)	Sjors Scheres (Medical Research Council Laboratory of Molecular Biology)	https://www3.mrc-lmb.cam.ac.uk/relion/
MUSCLE	European Molecular Biology Laboratory -European Bioinformatics Institute (EMBL-EBI)	https://www.ebi.ac.uk/Tools/msa/muscle/
cryoSPARC (v3.2, v4.0 & v4.1)	Structura Biotechnology	https://cryosparc.com/updates
CTFFIND-4.1	The Grigorieff Lab	https://grigoriefflab.umassmed.edu/ctffind4
AlphaFold (v2.0)	DeepMind	https://www.deepmind.com/open-source/alphafold
AlphaFold-multimer (v2.0)	DeepMind	https://github.com/deepmind/alphafold
ColabFold (v1.5.2)	Ovchinnikov & Steinegger Labs	https://github.com/sokrypton/ColabFold
Epson Scan 3.9.3.0EN	Seiko Epson Corporation	https://www.epson.co.uk
Amersham Typhoon (1.1.0.7)	Cytiva

Other

Amicon Ultra Centrifugal Filter Units	Millipore	Cat# UFC901096
QUANTIFOIL Copper 400 mesh R2/2 holey carbon TEM grids	Electron Microscopy Sciences	Cat# Q450CR2
HiTrap Blue HP	GE Healthcare	Cat# 17-0412-01
HiTrap DEAE Fast Flow	GE Healthcare	Cat# 17-5055-01
HiTrap Heparin HP	GE Healthcare	Cat# 17-0406-01
HiTrap SP HP	GE Healthcare	Cat# 29-0513-24
HiTrap SP FF	GE Healthcare	Cat# 29-0513-24
IgG Sepharose Fast Flow	GE Healthcare	Cat# 17-0969-01
StrepTactin Superflow high-capacity resin	IBA life sciences	Cat# 2-1208-002
MonoQ PC 1.6/5	GE Healthcare	Cat# 17-0671-01
MonoS 5/50 GL	GE Healthcare	Cat# 17-5168-01
Ni-NTA Agarose	QIAGEN	Cat# 30210
Superdex 200 Increase 10/300 GL	GE Healthcare	Cat# 28-9909-44
Superose™ 6 Increase 10/300 GL	GE Healthcare	Cat# 29-0915-96
Sepharose 4B	Sigma	Cat# 4B200
Microspin G-50 columns	GE Healthcare	Cat# GE27-5330-02
Anti-FLAG M2 affinity gel	Sigma	Cat# A2220
Bio-Gel HT (Hydrated) Hydroxyapatite	Bio-Rad	Cat# 130-0150
Calmodulin-Sepharose 4B	GE Healthcare	Cat# 17-0529-01
Criterion XT 4-12% Bis-Tris precast gels	BioRad	Cat# 3450124
NuPAGE™ 4-12% Bis-Tris precast gels	Thermo Fisher	Cat# NPO323box
Whatman 3 MM paper	Cytivia	Cat# 11895375
BAS-IP MS phosphor screen	Cytivia	Cat# 28956474
Amersham Hyperfilm MP	Cytivia	Cat# 28906842