Table 3.
Identified miRNAs. List of the expressed miRNAs detected by NGS analysis in the common mallow, together with their respective nucleotide sequence. The number of raw sequencing reads counted for each miRNA in the samples of leaves (i.e., LE01, LE02, LE03) and flowers (i.e., F01, F02, F03) were indicated
| miRNA | Sequence (5’-3’) | LE01 | LE02 | LE03 | F01 | F02 | F03 |
|---|---|---|---|---|---|---|---|
| miR156a | UGACAGAAGAGAGUGAGCAC | 1204 | 803 | 1063 | 203 | 424 | 374 |
| miR156b | UUGACAGAAGAUAGAGAGCAC | 556 | 356 | 452 | 140 | 140 | 96 |
| miR159 | UUUGGAUUGAAGGGAGCUCUA | 27,389 | 20,834 | 21,236 | 10,549 | 11,197 | 14,364 |
| miR159c-3p | CUUGGACUGAAGGGAGCUCCC | 221 | 207 | 87 | 4117 | 3397 | 4496 |
| miR160a | UGCCUGGCUCCCUGAAUGCCA | 2278 | 1706 | 1341 | 317 | 198 | 237 |
| miR160b-5p | UGCCUGGCUCCCUGUAUGCCG | 348 | 222 | 258 | 270 | 135 | 194 |
| miR164d-5p | UGGAGAAGCAGGGCACGUGCA | 249 | n.d.* | n.d. | 450 | 445 | 442 |
| miR166f-3p | UCGGACCAGGCUUCAUUCCCU | 23,685 | 17,879 | 18,657 | 8694 | 7830 | 9679 |
| miR166g-3p | UCUCGGACCAGGCUUCAUUCC | 556 | 368 | 408 | 314 | 265 | 266 |
| miR167d | UGAAGCUGCCAGCAUGAUCUUA | 3031 | 1613 | 2078 | 1132 | 796 | 944 |
| miR167e-5p | UGAAGCUGCCAGCAUGAUCUA | 6638 | 3461 | 4380 | 1133 | 797 | 837 |
| miR168-5p | UCGCUUGGUGCAGGUCGGGAA | 896 | 547 | 524 | 129 | 80 | n.d. |
| miR172b-3p | AGAAUCUUGAUGAUGCUGCAU | 153 | 133 | 160 | n.d. | n.d. | n.d. |
| miR172c | UGAAUCUUGAUGAUGCUACGC | 15,076 | 9785 | 14,957 | 2587 | 2172 | n.d |
| miR172c-5p | AGCAUCUUCAAGAUUCACA | 484 | n.d. | 442 | n.d. | n.d. | n.d. |
| miR393c-5p | UCCAAAGGGAUCGCAUUGAUC | 231 | n.d. | 215 | 394 | n.d. | 373 |
| miR395c-3p | CUGAAGUGUUUGGGGGAACUC | 1480 | 1504 | 1695 | 1816 | 2047 | 2050 |
| miR396a | UUCCACAGCUUUCUUGAACUG | 30,763 | 13,649 | 13,059 | 335 | 198 | 226 |
| miR396c-3p | GUUCAAUAAAGCUGUGGGAAG | n.d. | n.d. | n.d. | 3201 | 3183 | 3607 |
| miR396f-5p | UUCCACAGCUUUCUUGAACUU | 6359 | 3658 | 4000 | 385 | 241 | 463 |
| miR398b | UGUGUUCUCAGGUCACCCCU | 35 | n.d. | n.d. | n.d. | n.d. | n.d. |
| miR398b-3p | UGUGUUCUCAGGUCGCCCCUG | 316 | 211 | 146 | 59 | n.d | 55 |
| miR399c | CGCCAAAGGAGAGUUGCCCUG | 38 | n.d. | n.d. | n.d. | n.d. | n.d. |
| miR399d | UGCCAAAGGAGAGUUGCCCUG | 88 | n.d. | n.d. | 106 | 100 | n.d. |
| miR399e-3p | UGCCAAAGGAGAUUUGCCCGG | n.d. | n.d. | n.d. | 30 | n.d. | n.d. |
| miR399f-3p | CGCCAAAGGAGAAUUGCCCUG | 44 | n.d. | n.d. | n.d. | n.d. | n.d. |
| miR403b-3p | UUAGAUUCACGCACAAACUCG | 264 | 226 | 190 | n.d. | n.d. | n.d. |
| miR482a | UCUUUCCUACUCCUCCCAUUCC | 118 | 79 | 64 | n.d. | n.d. | n.d. |
| miR530b | UGCAUUUGCACCUGCACCUUA | n.d. | n.d. | 108 | n.d. | n.d. | n.d. |
| miR2118 | UUGCCGAUUCCACCCAUUCCUA | 82 | n.d. | 55 | n.d. | n.d. | n.d. |
| miR3954b-5p | UUAGAUUCACGCACAAACUCG | 690 | 384 | 512 | 401 | 395 | 444 |
| miR6300 | GUCGUUGUAGUAUAGUGG | 287 | n.d. | n.d. | 7083 | 8385 | 6150 |
| miR8051-5p | UAGUAUGGUAGAAAGAUUCA | 350 | n.d. | n.d. | n.d. | n.d. | n.d. |
*n.d. not detected