Abstract
The purpose of this experiment was to explore the effects of zinc supplementation in breeding pigeons diet on carcass traits, meat quality, antioxidant capacity and mRNA expressions of myogenic regulatory factors of squabs. A total of 120 healthy White King pigeons were randomly assigned to 5 treatments, each involving 8 replicates. The experiment lasted for 46 d (18-d incubation period of eggs and 28-d growth period of squabs). The 5 groups were 0, 30, 60, 90, and 120 mg/kg zinc addition. Results showed that the 28-d body weight, breast muscle yield, zinc content in crop milk and myogenic factor 6 (MyF6) abundance of breast muscle were linearly increased (P < 0.050), but the abdominal fat yield linearly decreased (P = 0.040) with increasing dietary zinc supplementation. Both the linear (P < 0.050) and quadratic responses (P < 0.001) were observed in copper zinc superoxide dismutase (Cu-Zn SOD), total antioxidant capacity (T-AOC) and malondialdehyde (MDA) contents in liver and breast muscle. The 28-d body weight was increased by 90 mg/kg zinc supplementation (P < 0.05), and there is no significant difference between 90 and 120 mg/kg zinc addition. The breast muscle yield, Cu-Zn SOD and T-AOC contents in breast muscle and liver, zinc contents in crop milk and breast muscle, MyF6 mRNA expression in breast muscle were higher (P < 0.05) in the group supplemented with 120 mg/kg zinc than the control. The abdominal fat yield was numerically lowest, and MDA contents in breast muscle and liver were significantly lowest in the group fed 120 mg/kg zinc (P < 0.05). However, the meat quality traits were not affected (P > 0.05) by zinc supplementation, except for shear force. It should be stated dietary zinc supplementation at the level of 120 mg/kg for breeding pigeons increased body weight and breast muscle yield of squabs, which may be associated with the up-regulating MyF6 mRNA expression and antioxidant capacity in liver and breast muscle.
Key words: zinc nutrition, carcass trait, myogenic factor 6, antioxidant property, pigeon
INTRODUCTION
Pigeon breeding has become the fourth mainstream poultry industry after chickens, ducks and geese (Ji et al., 2020). Pigeon meat is characterized by high nutritive value due to low cholesterol and high levels of protein, vitamins, calcium, iron and zinc (Pomianowski et al., 2009; Mahdy, 2021). It has been considered as a delicious and healthy food and it is gaining more and more popular among consumers from Europe and many countries such as Egypt, China, USA, and Japan (Wang et al., 2022). Different from chickens, pigeons were raised in pairs with a 2-egg clutch and a nearly 47-d breeding clutch interval. The slowly reproductive performance leads to a lower squabs production than other poultry each year. Now, the pigeon industry in China is focusing on the improvement of growth rate, carcass yield, and meat quality of squabs to increase profitability and meet the demands of consumers for healthier and more nutritious meat (Ye et al., 2018). The poultry production is associated with various stresses that reduce carcass yield and meat quality. Research has shown that most of the stress in poultry production at the cellular level is related to oxidative stress, including lipid peroxidation and protein oxidation (Surai et al., 2019). Additionally, the growth rate and carcass yield of pigeons was closely related with muscle growth and development. Muscle regulatory factors related genes have important roles in muscle fiber development, muscle formation and growth, and meat quality (Li et al., 2022).
As an important nutritional strategy, micromineral supplementation of diets is some of the widespread and necessary practices within poultry production (Savaris et al., 2021). Zinc is the second most abundant trace element (second only to iron) and is essential for all living organisms (Qin et al., 2011), which is proposed to be the first limiting mineral on growth performance among these 4 trace elements (copper, iron, manganese, and zinc) (Bao et al., 2010). Researches from different teams found that zinc supplementation improved growth performance and carcass yield of broilers (Liu et al., 2011; Khajeh bami et al., 2020). It also has been demonstrated that zinc supplementation has the potential to improve meat quality of broilers with various research contradictions (Ogbuewu and Mbajiorgu, 2022). Zinc deficiency can impair the growth rate of fast-growing animals by decreasing muscle protein anabolism and increasing catabolic response (Wen et al., 2019), disturbing synthesis of haemoglobin and reducing building and function of the musculoskeletal system (Kwiecien et al., 2017; Winiarska-mieczan et al., 2021). Zinc is also an indispensable component of the antioxidant system in animals (Oteiza 2012). Research with broilers and ducks demonstrated that zinc supplementation could improve the meat quality, which can be attributed to the increased muscular antioxidant capacity (Liu et al., 2015; Wen et al., 2019). Whether zinc supplementation could also improve carcass traits, meat quality, antioxidant capacity and tissue zinc contents of squabs are undetermined so far.
Most notably, there is currently a lack of zinc nutritional recommendation for pigeons from National Research Council or published studies. Therefore, it is very necessary to determine the appropriate zinc level in pigeons diet for obtaining the better growth performance, carcass traits and meat quality. In previous study, we analyzed the zinc content in pigeon diets from 16 different regions and sources diets (Beijing; Shijiazhuang, Hebei; Xingtai, Hebei; Liaocheng, Shandong; Qingdao, Shandong; Rizhao, Shandong; Benxi, Liaoning; Panjin, Liaoning; Xianyang, Shanxi; Fuyang, Anhui; Changsha, Hunan; Mianyang, Sichuan; Guangzhou, Guangdong; Huizhou, Guangdong; Jiangmen, Guangdong; Guilin, Guangxi), with an average of about 89 mg/kg diet (data not published). Additionally, the amount of zinc supplementation in poultry diet has been limited to no more than 120 mg/kg diet in China. Besides, young squabs cannot eat independently after birth due to their late maturity (Chen et al., 2020). After hatching, they are fed by parents (breeding pigeons) in a mouth-to-mouth manner for nearly 28 d (Shao et al., 2021). Thus, the objective of this study was to define the effect of dietary supplementation with different levels of zinc (0, 30, 60, 90, and 120 mg/kg diet) in breeding pigeons on growth performance, carcass traits, meat quality, antioxidant activity of squabs and the related mechanisms.
MATERIALS AND METHODS
The study was approved by the Animal Care and Use Committee of the Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences (IAHVM-BAAFS), Beijing, China.
Experimental Birds and Diets
A total of 120 male-female pairs of healthy White King pigeons (1.5 years old) with similar weights and sizes were randomly assigned to 5 treatments, each involving 8 replicates and 3 cages per replicate, and a pair of breeding pigeons (1 male and 1 female) were raised in each cage (50 × 50 × 60 cm2). The 2 fertile eggs were hatched by a pair of breeding pigeons and 2 squabs were raised by their parent breeding pigeons. The experiment lasted for 46 d (18-d incubation period of eggs and 28-d growth period of squabs). As soon as the eggs were laid, the breeding pigeons start receiving the experimental diets. The 5 groups of breeding pigeons were fed the control diet without zinc supplementation and the control diet supplemented with 30, 60, 90 and 120 mg/kg zinc. The zinc source in the diet was zinc sulfate heptahydrate (analytical pure), purchased from Sinopharm Chemical Reagent Co., Ltd. The dietary zinc level by analysis on an as-fed basis was 22.93, 57.79, 88.71, 110.98 and 148.79 mg zinc/kg diet in 5 groups. The birds were provided with diets and water ad libitum with a lighting cycle of 16 h light and 8 h darkness. The mean daily temperature was 22 ± 6°C. The pigeons were fed a pellet feed based on corn, peas, soybean, wheat, and sorghum. The basal diet was formulated to meet the nutrient requirements of breeding pigeons as referenced in a previous study (Chen et al., 2020). The compositions and nutrient levels of the basal diet are shown in Table 1. The crude protein in feed was determined by the Kjeldahl method. The Ca content in diet samples were determined by the EDTA complex titration method (McCormick, 1973). The total P content was measured colorimetrically using vanadate-molybdate spectrophotometry (Davies et al., 1973). At 1 and 28 d of age, squab weights were recorded.
Table 1.
Composition and nutrient levels of the basal diet (air-dry basis).
| Ingredients | Content (%) | Nutrient composition | |
|---|---|---|---|
| Corn | 41.000 | Metabolizable energy, MJ/kg | 11.89 |
| Soybean | 13.125 | Crude protein,4 % | 15.85 |
| Pea | 17.420 | Calcium, % | 1.11 |
| Wheat | 12.800 | Phosphorus,4 % | 0.74 |
| Sorghum | 10.400 | Lys, % | 0.88 |
| Soybean oil | 0.700 | Met, % | 0.36 |
| CaHPO4·2H2O | 2.087 | Zinc,4 mg/kg | 25.22 |
| Limestone | 1.350 | ||
| NaCl | 0.400 | ||
| Cornstarch+zinc1 | 0.257 | ||
| Vitamin premix2 | 0.030 | ||
| Choline chloride | 0.040 | ||
| Mineral premix3 | 0.101 | ||
| Lysine | 0.160 | ||
| DL-Methionine | 0.130 | ||
| Total | 100 |
Zinc source replaces equal quality corn starch.
Complex vitamins are provided per kilogram of feed: VA 13500IU, VD3 3600IU, VE 36IU, VK3 4.5 mg, VB1 3.6 mg, VB2 11.25 mg, D-pantothenic acid 16.5 mg, nicotinamide 39 mg, folic acid 2.1 mg and biotin 0.24 mg.
Trace components are provided per kilogram of feed: iron 150 mg, copper 8 mg, manganese 65 mg, iodine 0.35 mg, selenium 0.25 mg.
Analyzed values and each value based on triplicate determinations, and other nutrients were calculated values.
Sample Collection
On the 28th d of the experiment, the pigeons were subjected to 12-h of feed withdrawals. One squab was randomly selected from each replicate (totally, 8 squabs were selected from each treatment). The squabs were kept for blood sampling aseptically from the wing portal vein and then euthanized by cervical dislocation. The serum was obtained after centrifuging at 3000 × g for 10 min at 4°C and stored at -20°C for analysis of antioxidant function. After that, the squab crop was cut open to collect approximately 1 g of crop milk into 5 mL tubes for analysis of zinc content. A part of right liver and left pectoralis major muscle were collected and stored at -20°C for analysis of antioxidant function and zinc concentration. The other part of left pectoralis major muscle was snap-frozen in liquid nitrogen for analysis of mRNA expressions. Besides, another one squab from each replicate was randomly selected, weighted and slaughtered by cervical dislocation for determination of carcass traits. After that, the right pectoralis major muscle was collected ultimately for meat quality analysis, including pH, color, drip loss, cooking loss and shear force.
Carcass Traits
The slaughtered squabs were scalded at 60°C for 30 s, and then the mechanical depilation was carried out. After removing the feathers, the carcasses were weighed. The semi-eviscerated weight was calculated by detaching the trachea, esophagus, full crop, intestine, pancreas, spleen, gizzard contents, cutin- membrane, and gonads from the carcass. The eviscerated weight was calculated by removing the head, heart, liver, proventriculus, gizzard, abdominal fat, and feet from the semi-eviscerated carcass. The total breast muscle and abdominal fat were separated and weighed. The carcass yield, eviscerated yield and semi-eviscerated yield were calculated as percentages of the live body weight of squabs. The breast muscle yield was calculated as a percentage of eviscerated weight. The abdominal fat yield was calculated as a percentage of sum of weights of eviscerated and abdominal fat (Zhang et al., 2020).
Meat Quality for Breast Muscle
According to the method reported by Christensen (2003), the dripping loss was measured immediately after slaughter. In brief, the pectoralis major muscle was trimmed and weighed, then suspended in a sealed plastic bag and stored at 4°C. After 24 h, the muscles were removed from the bag, and then wiped and weighed. The drip loss was defined as the percentage of the loss in weight to the initial muscle weight.
After 24 h of slaughter, the pH, meat color, shear force and cooking loss were determined. The pH of pectoralis major muscle was measured at 3 different points with 1 cm depth below the muscle surface using a portable pH meter equipped with a combination spear tip electrode (pH-STAR, Matthaus Corporation, Germany) as previously described (Huang et al., 2016). The meat color, including luminance value (L*), redness value (a*), and yellowness value (b*) were determined at 3 different points on the inner surface (in contact with the pectoralis major muscle) using LabScan XE desktop standard spectrophotometer (Hunterlab, VA). Prior to obtaining color values, the instrument was calibrated on a black glass then a white enamel tile as directed by the manufacturer's specifications. Besides, the muscle with 2.5 cm length, 1.0 cm width, 0.5 cm depth was heated in a thermostatic water bath until the core temperature reached 75°C, and then cooled to room temperature for measuring the shear force at 3 different points using a tenderness meter (C-LM1, Matthias, Germany) set with a 200 nm/min crosshead speed. The cutting line was positioned perpendicular to the muscle fiber orientation, and avoiding obvious fat and tendons. The peak value was recorded for 3 technical replicates. All the data of pH, meat color and shear force were the average value measured at 3 different points. Cooking loss was measured according to Brambila et al., (2018) with slight modifications. Briefly, all samples were weighed before cooking, and then wrapped and cooked in a water bath at 80°C until the thickest part of the sample reached 70°C. After cooking, they were cooled to room temperature, and then wiped and weighed. The cooking loss was calculated by the percentage of weight change before cooking and after cooking.
RNA Extraction, Reverse Transcription, and Real‑time Quantitative PCR
Total RNA was isolated using Trizol reagent (Vazyme Cat. R401-01) and reversely transcribed into cDNA according to the manufacturer's instructions. The concentration of total RNA was estimated by measuring its optical density at 260 and 280 nm with a spectrophotometer (ND-100, NanoDrop Technologies). Then, the total RNA was reversely transcribed into cDNA using One-Step gDNA Removal and cDNA HiScript Ⅲ All-in-one RT SuperMix (Vazyme Cat. R333-01) according to the manufacturer's instructions. cDNA was used as templates for real-time quantitative PCR amplification using Taq Pro Universal SYBR qPCR Master Mix (Vazyme Cat. Q712-02) in the Bio-Rad CFX96 Real-Time PCR machine following the manufacturer's instruction. The relative standard-curve method was used to quantify the mRNA concentrations of each gene in relation to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The gene-specific primers for myogenic factor 6 (MyF6), myogenin (MyoG), myogenic factor 5 (MyF5), and GAPDH are given in Table 2. Relative gene expression was calculated using the 2−ΔΔCt method. All the samples were analyzed in triplicates.
Table 2.
Real-time PCR primers.
| Gene | GenBank number | Primer sequence (5′-3′) | Length |
|---|---|---|---|
| GAPDH | NM_001282835 | Forward:GTCAGCAATGCCTCTTGCAC Reverse:GATGGCATGGACAGTGGTCA |
105bp |
| MyF6 | XM_021299920 | Forward:GAACCCGGTTGCTCTTGGTA Reverse:GGGTGGTGTACCTTGACTCG |
140bp |
| MyoG | XM_021291422 | Forward:AAATTTCCTGGGCTCCCGTT Reverse:GTCTTGCGCTTGCAAACCTT |
174bp |
| MyF5 | XM_021299921 | Forward:AGGCGTTTGAGACCCTGAAG Reverse:TCCCGGCAGGTGATAGTAGT |
149bp |
Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MyF6, myogenic factor 6; MyoG, myogenin; MyF5, myogenic factor 5.
Antioxidant Parameters
The antioxidant indexes in serum, liver and breast muscle, including copper zinc superoxide dismutase (Cu-Zn SOD), malondialdehyde (MDA) and total antioxidant capacity (T-AOC) were determined. The tissues of liver and breast muscle were prepared into homogenates. In brief, approximately 0.5 g liver or breast muscle was homogenized in 10 volumes of ice-cold physiological saline and centrifuged at 5000 g for 10 min at 4°C to obtain the supernatant. The obtained supernatants were used to determine the antioxidant indexes and protein concentrations. The results in serum were expressed as units per millilitre serum, and in tissue as units per milligrams protein.
The level of MDA was determined using the tiobarbituric acid (TBA) method. The serum or the supernatant of liver or breast muscle was mixed with 0.1% hydrochloric acid solution in a centrifuge tube. Next, 2% TBA solution was added and mixed in a vortex mixer. Afterwards, the mixture was put in a boiling water bath for 80 min to develop the color, and then cooled and centrifuged at 4,000 × g for 10 min to obtain the supernatant. The absorbance of supernatant was measured at a wavelength of 532 nm in a spectrophotometer.
The total SOD activity was determined using the xanthine oxidase method, which includes Cu-Zn SOD activity and Mn SOD activity, and the Cu-Zn SOD activity was determined after deactivating Mn SOD activity. The reaction mixture contained 0.1 M PBS, 0.5% riboflavin solution, 0.2% EDTA-Na2 solution, and 0.5% nitroblue tetrazolium in 37°C water bath for 30 min. The absorbance at 560 nm was monitored in a spectrophotometer.
The T-AOC was based on determination of the ferric reducing ability assay (Benzie and Strain, 1996). The sample was mixed with 1% phenanthroline solution and 0.1M PBS in 37°C for 30 min. Next, 0.5% ferrous sulfate solution was added and mixed at room temperature for 6 min. The absorbance at 632 nm was monitored in a spectrophotometer.
Assays of Zinc Concentrations and Nutrient Composition
The basal diet and crop milk were determined on a dry- matter basis, and the liver and breast muscle were based on a wet-tissue material. Approximately 0.5 g of diet, crop milk, liver or breast muscle was digested with 10 mL HNO3:HClO4 (5:1 vol/vol) acid mixture in a 50-mL triangular flask at 160°C using a sand heater until the solution was boiled to emit white smoke and become colorless. After cooling, the digested samples were diluted with deionized water and transferred to a 100-mL volumetric flask. Zinc concentrations were determined by inductively coupled plasma emission spectroscope (ICP-9000, Shimadzu, Japan).
Statistical Analysis
Analysis was performed using a completely randomized design. All of the data were analyzed by one-way ANOVA among 5 groups through the use of SPSS statistical software (version 25.0). Least significant difference multiple comparison procedure was implemented to test the differences in significance. When a significant difference was observed among 5 groups, the polynomial orthogonal contrasts were used to determine the linear and quadratic responses of dependent variables to dietary zinc levels (Kamely et al., 2016). The data are presented as means ± SEMs. Data from slaughter performance, drop loss and cooking loss were transformed to arcsine for analysis. The regression analysis of the broken line model and the quadratic model were used to estimate the optimal levels of zinc. Differences were considered significant at P < 0.05 and a tendency was defined as 0.05 ≤ P< 0.10.
RESULTS
Body Weight and Slaughter Performance of Squabs
The effects of dietary zinc supplementation on the body weight and slaughter performance of squabs are shown in Table 3. The 28-d body weight (P = 0.013) and breast muscle yield (P = 0.002) linearly increased with the increase of dietary zinc supplementation, but the abdominal fat yield linearly decreased (P = 0.040) with the increase of dietary zinc supplementation. The 28-d body weight was significantly increased by 90 mg/kg zinc supplementation (P = 0.017), and there is no significant difference between 90 and 120 mg/kg zinc supplementation. The breast muscle was significantly increased by 90 and 120 mg/kg zinc supplementation (P = 0.031). Besides, a quadratic response was tended to be shown in the abdominal fat yield of squabs (P = 0.081), and the abdominal fat yield was numerically lowest in the group supplemented with 120 mg zinc/kg diet among different groups, and it was reduced by 18.58% in the group supplemented with 120 mg zinc/kg diet compared with that in the control group. There was no significant difference in the 1-d body weight, carcass yield, semi-eviscerated yield and eviscerated yield among different groups (P > 0.05).
Table 3.
Effects of dietary zinc supplementation in breeding pigeons diet on body weight and slaughter performance of squabs.
| Items | 1d BW (g)1 | 28d BW (g)1 | Carcass yield (%)2 | Semi-eviscerated yield (%)2 | Eviscerated yield (%)2 | Abdominal fat yield (%)2 | Breast muscle yield (%)2 | |
|---|---|---|---|---|---|---|---|---|
| Zinc supple-mental levels | 0 | 22.22 ± 0.67 | 517.4 ± 4. 7b | 83.86 ± 0.50 | 77.45 ± 0.60 | 69.75 ± 0.59 | 1.13 ± 0.14ab | 24.86 ± 0.41b |
| 30 | 23.54 ± 1.37 | 516.8 ± 12.4b | 84.02 ± 0.71 | 77.35 ± 0.96 | 69.36 ± 0.66 | 1.13 ± 0.07ab | 25.65 ± 0.45ab | |
| 60 | 22.30 ± 1.17 | 515.0 ± 5.2b | 83.00 ± 0.38 | 77.02 ± 0.47 | 69.49 ± 0.36 | 1.42 ± 0.12a | 25.68 ± 0.64ab | |
| 90 | 22.20 ± 0.84 | 551.1 ± 10.2a | 82.71 ± 1.02 | 76.25 ± 1.13 | 68.54 ± 1.38 | 0.95 ± 0.13b | 26.66 ± 0.45a | |
| 120 | 22.05 ± 0.82 | 534.9 ± 6.7ab | 84.10 ± 0.54 | 77.20 ± 0.45 | 69.61 ± 0.50 | 0.92 ± 0.07b | 27.29 ± 0.64a | |
| P-value | zinc level | 0.832 | 0.017 | 0.472 | 0.826 | 0.831 | 0.031 | 0.031 |
| Linear | - | 0.013 | - | - | - | 0.040 | 0.002 | |
| Quadratic | - | 0.833 | - | - | - | 0.081 | 0.762 |
Data were presented as mean ± SEM.
Means in the same column without a letter in common are different (P < 0.05). -, When no significant difference was observed by one-way ANOVA among 5 groups, the linear and quadratic responses are no longer analyzed.
Data represent the mean values of 8 replicates with 6 squabs per replicate (n = 8).
Data represent the mean values of 8 replicates with 1 squab per replicate (n = 8).
Meat Quality of Squabs
The effects of dietary zinc supplementation on the meat quality of pectoralis major muscle from squabs are shown in Table 4. Compared with control group, dietary supplementation of 30 mg zinc/kg diet significantly decreased the shear force of major pectoral muscle (P = 0.022). However, neither a linear nor quadratic response (P > 0.220) was observed in the shear force. Dietary zinc supplementation had no effects on pH, drip loss, cooking loss and the color score including the lightness, redness and yellowness (P > 0.05).
Table 4.
Effects of dietary zinc supplementation in breeding pigeons diet on the meat quality of pectoralis major muscle from squabs.
| Items | Zinc supplemental levels |
P-value |
||||||
|---|---|---|---|---|---|---|---|---|
| 0 | 30 | 60 | 90 | 120 | Zinc level | Linear | Quadratic | |
| L* | 42.74 ± 0.72 | 43.69 ± 0.43 | 42.12 ± 0.80 | 44.27 ±0.71 | 43.34 ± 0.52 | 0.188 | - | - |
| a* | 19.38 ± 0.55 | 19.27 ± 0.57 | 18.60 ± 0.48 | 18.24±0.79 | 18.61 ± 0.95 | 0.740 | - | - |
| b* | 7.85 ± 0.79 | 7.26±0.98 | 7.45 ± 0.55 | 7.61 ± 0.61 | 6.82 ± 0.31 | 0.862 | - | - |
| Shear force/N | 51.31 ± 1.78a | 43.06 ± 4.05b | 47.12 ± 2.40ab | 54.35 ± 2.81a | 49.72 ± 3.71a | 0.022 | 0.233 | 0.221 |
| pH | 5.76 ± 0.05 | 5.65 ± 0.03 | 5.65 ± 0.05 | 5.72 ± 0.05 | 5.68 ± 0.05 | 0.423 | - | - |
| drip loss/% | 0.49 ± 0.14 | 0.79 ± 0.29 | 0.67 ± 0.15 | 0.72 ± 0.09 | 0.66 ± 0.15 | 0.809 | - | - |
| Cooking loss/% | 6.50 ± 0.31 | 7.29 ± 0.57 | 6.81 ± 0.33 | 6.47 ± 0.48 | 7.56 ± 0.27 | 0.250 | - | - |
Data were presented as mean ± SEM, and they represent the mean values of 8 replicates with 1 squab per replicate (n = 8).
L*, luminance; a*, redness; b*, yellowness.
Means in the same column without a letter in common are different (P < 0.05). -, When no significant difference was observed by one-way ANOVA among 5 groups, the linear and quadratic responses are no longer analyzed.
Effect of Dietary Zinc Supplementation in Breeding Pigeons Diet on Antioxidant Parameters of Squabs
The effects of dietary zinc supplementation on the antioxidant parameters of squabs are shown in Table 5. Both the linear response (P < 0.050) and quadratic response (P < 0.001) were observed in the Cu-Zn SOD, T-AOC and MDA contents in liver and breast muscle. The Cu-Zn SOD and T-AOC contents in the liver and breast muscle were significantly increased by zinc supplementation followed by a significant decrease in the diet supplemented with 60 mg/kg zinc, and then increased with the increasing dietary zinc levels (P < 0.001). On the contrary, the MDA contents in the liver and breast muscle were significantly decreased by zinc supplementation followed by a significant increase in 60 mg/kg zinc supplementation, and then decreased with the increasing dietary zinc levels (P < 0.001). In summary, squabs supplemented with 120 mg zinc/kg diet had the highest contents of T-AOC and Cu-Zn SOD and the lowest contents of MDA in the liver and breast muscle among 5 groups. There was no significant difference in 3 antioxidant parameters in serum of squabs among 5 groups (P > 0.400).
Table 5.
Effects of dietary zinc supplementation in breeding pigeons diet on the antioxidant parameters in serum, liver and breast muscle of squabs.
| Items | Zinc supplemental levels (mg/kg) |
P-value |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| 0 | 30 | 60 | 90 | 120 | Zinc level | Linear | Quadratic | ||
| Serum | Cu-Zn SOD (U/mL) | 116.76 ± 2.29 | 119.56 ± 1.42 | 120.58 ± 0.90 | 120.30 ± 1.17 | 116.65 ± 2.84 | 0.407 | - | - |
| T-AOC (U/mL) | 0.83 ± 0.01 | 0.84 ± 0.01 | 0.86 ± 0.01 | 0.83 ± 0.02 | 0.82 ± 0.03 | 0.671 | - | - | |
| MDA (nmol/mL) | 2.68 ± 0.24 | 3.71 ± 0.69 | 3.22 ± 0.29 | 3.48 ± 0.16 | 3.32 ± 0.26 | 0.403 | - | - | |
| Liver | Cu-Zn SOD (U/mg protein) | 11.94 ± 0.29d | 15.23 ± 0.09b | 10.28 ± 0.28e | 13.77 ± 0.20c | 17.46 ± 0.57a | <0.001 | <0.001 | <0.001 |
| T-AOC (U/mg protein) | 1.57 ± 0.09d | 2.29 ± 0.08b | 1.07 ± 0.06e | 2.01 ± 0.05c | 2.91 ± 0.09a | <0.001 | 0.033 | <0.001 | |
| MDA (nmol/ mg protein) | 1.14 ± 0.02b | 0.91 ± 0.03c | 1.37 ± 0.06a | 1.02 ± 0.03bc | 0.59 ± 0.05d | <0.001 | <0.001 | <0.001 | |
| Breast muscle | Cu-Zn SOD (U/mg protein) | 5.37 ± 0.24d | 6.96 ± 0.15b | 4.13 ± 0.09e | 6.47 ± 0.18c | 7.80 ± 0.13a | <0.001 | <0.001 | <0.001 |
| T-AOC (U/mg protein)) | 1.10 ± 0.03c | 1.32 ± 0.06b | 0.89 ± 0.02d | 1.21 ± 0.01bc | 1.65 ± 0.04a | <0.001 | <0.001 | <0.001 | |
| MDA (nmol/ mg protein)) | 0.58 ± 0.09bc | 0.48 ± 0.02cd | 1.07 ± 0.03a | 0.61 ± 0.02b | 0.36 ± 0.02d | <0.001 | <0.001 | <0.001 | |
Abbreviations: Cu-Zn SOD, copper zinc superoxide dismutase; MDA, malondialdehyde; T-AOC, total antioxidant capacity.
Data were represented as mean ± SEM, and they represent the mean values of 8 replicates with 1 squab per replicate (n = 8).
Means in the same column without a letter in common are different (P < 0.05). -, When no significant difference was observed by one-way ANOVA among 5 groups, the linear and quadratic responses are no longer analyzed.
Zinc Contents in Crop Milk, Liver and Breast Muscle of Squabs
The zinc content in pigeon milk was linearly (P < 0.001, Figure 1A) increased with the increase of dietary zinc addition. Neither a linear nor quadratic response (P > 0.050) was observed in the zinc content in breast muscle. Dietary zinc supplementation tended to increase the zinc content in breast muscle (P = 0.066, Figure 1C), and the group supplemented with 120 mg zinc/kg diet had significantly higher zinc content than the control group (P = 0.037). The zinc content in liver of squabs was not affected by dietary zinc supplementation (P = 0.261, Figure 1B).
Figure 1.
Zinc contents in pigeon milk (A), liver (B) and breast muscle (C). Data were presented as mean ± SEM, and they represent the mean values of 8 replicates with 1 squab per replicate (n = 8). Values with different small letters are significantly different (P < 0.05). When no significant difference was observed by one-way ANOVA among 5 groups, the linear and quadratic responses are no longer analyzed.
Myogenic Factor Gene Expressions in Breast Muscle of Squabs
Dietary zinc supplementation tended to affect the MyF6 mRNA expression in the pectoralis major muscle (P = 0.081, Figure 2A), and a linear response was observed in the abundance of MyF6 of the pectoralis major muscle (P = 0.024, Figure 2A). Dietary supplementation of 120 mg zinc/kg diet had significantly higher (P = 0.007) abundance of MyF6 in the breast muscle of squabs than the control group. However, the mRNA expressions of MyoG and MyF5 were not affected (P > 0. 590, Figure 2B, C) by zinc supplementation.
Figure 2.
Dietary zinc supplementation abundance of mRNA in breast muscle of squabs. (A) MyF6 mRNA expression, (B) MyF5 mRNA expression, (C) MyoG mRNA expression. Data were represented as mean ± SEM, and they represent the mean values of 8 replicates with 1 squab per replicate (n = 8). Values with different small letters are significantly different (P < 0.05). When no significant difference was observed by one-way ANOVA among 5 groups, the linear and quadratic responses are no longer analyzed. MyF6, myogenic factor 6; MyF5, myogenic factor 5; MyoG, myogenin.
Evaluation of Optimal Zinc Levels in Breeding Pigeons Diet
From the above results, only the Cu-Zn SOD, T-AOC and MDA contents in liver and breast muscle were quadratically changed with the increase of dietary zinc levels. Therefore, these data were further analyzed by the nonlinear regression models (the quadratic model, the broken line model, and the asymptotic model) for estimating the optimal zinc level. The nonlinear regression analyses showed that the asymptotic equations were not significant (P > 0.050, data were shown). Although the quadratic equations (P < 0.001, supplemental figure 1) and the broken line equations (P < 0.050, supplemental figure 2) were significant, they were not suitable for evaluating the zinc requirements. The reasons for that were as follows: Firstly, the quadratic equations showed that the Cu-Zn SOD and T-AOC contents of liver and breast muscle had no maximum values, and MDA contents had no minimum values. Similarly, the broken line equations showed that the Cu-Zn SOD and T-AOC contents of breast muscle had no maximum values, and MDA contents of liver and breast had no minimum values. Notably, the Cu-Zn SOD and T-AOC contents of liver had the maximum values in the broken line equations, and the corresponding zinc levels were 130.735 (supplemental figure 2D) and 219.017 (supplemental figure 2F), respectively. However, they exceeded the highest level of zinc added in this study (120 mg/kg), and they also could not be used to estimate the optimal zinc level. Therefore, all the data were not be used to estimate the zinc requirement in breeding pigeons diet in the study.
DISCUSSION
The squabs are fed crop milk by parents (breeding pigeons) in a manner of mouth-to-mouth for nearly 28 d (Shao et al., 2021). Our present study found that the zinc content in crop milk was linearly increased with the increase of zinc supplementation in breeding pigeons diet, showing that dietary zinc taken by breeding pigeons has been passed on to squabs for their growth and development. And, it was confirmed that the storage of zinc in breast muscle was increased with the increasing levels of zinc in the pigeon diet, especially in the diet supplemented with 120 mg/kg zinc. This indicates that squab meat may be an important source of zinc nutrition, and consumption of squab meat could increase the intake of dietary zinc and alleviate the risk of zinc nutritional deficiency.
The meat-type pigeon industry is now focusing on increasing growth rate and improving meat quality of squabs to meet the demands of consumers (Ye et al., 2018). It has been demonstrated that zinc supplementation in broiler breeders’ diet could increase protein synthesis and decrease protein degradation, which, in turn, enhance breast muscle development of the offspring (Gao et al., 2014). Our present study showed that the breast muscle yield and the abdominal fat yield of squabs were linearly improved with the increasing zinc levels, mainly in the high levels of dietary zinc sulfate supplementation (90 and 120 mg zinc/kg diet). The weights of slaughtered, eviscerated and the yield of breast or leg muscle of Pekin ducks were increased with increasing dietary zinc supplementation in a linear and quadratic manner (15, 30, 60, 120, 240 mg zinc/kg diet) (Wen et al., 2019). Zhang et al. (2014) reported that the lean meat, fat meat, lean eye area, and back fat thickness of piglets were increased with supplementation of dietary zinc amounts (250–760 mg ZnO/kg diet). However, it was reported by Jahanian and Rasouli (2015) that dietary inclusion of low level of zinc-methionine with 10 to 40 mg/kg in place of inorganic zinc could improve carcass and breast meat yields and reduce abdominal fat percentage of broilers. It is true that many countries tend to limit the use of inorganic zinc in the livestock and poultry production for the environmental pollution problems. At present, there is still no relevant information about the effect of inorganic and organic zinc on the carcass and meat quality of pigeons. Therefore, the effects of inorganic zinc were studied firstly in present study, and the influences of organic zinc will be further explored in the future study, so as to improve the utilization of zinc and environmental contamination.
It is very important for us to find the relevant mechanism of zinc increasing the breast muscle yield of squabs. In the present experiment, dietary supplementation of 120 mg/kg zinc in breeding pigeons diet increased the mRNA expression of MyF6 in breast muscle of squabs, but did not affect gene expressions of the other 3 muscle regulatory factors. This indicated that diet with high level of zinc might promote breast muscle yield by upregulating the transcriptional level of MyF6 in the breast muscle of squabs. Previous studies have indicated that MyF6 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool, and it was considered as a muscle determination factor in the absence of MyF5 and myogenic differentiation (Lazure et al., 2020). There are no published studies on MyF6 gene expression and its effect on myogenesis during the growth and development of squabs.
The meat quality, such as pH value, shear force, color, dripping loss and cooking loss etc., is crucial to meat production (Kim and Kang, 2022). Currently, there is limited information on the effects of dietary zinc supplementation on pigeon meat quality. Zinc could bind to myoglobin and boost its oxygenation, helping to preserve meat color. A previous study has shown the addition of zinc lysine or nano zinc oxide at the level of 40 mg zinc/kg diet can be effective in general meat quality by increasing the brightness (L*) of broiler chickens (Alian et al., 2023). Salek et al. (2020) also reported that dietary supplementation of 37.5 to 62.5 mg/kg zinc-methionine plus 18.8 to 31.3 mg/kg ZnO has a positive effect on the color (a*) of pectoralis major muscle in broiler chickens. However, the meat color of pectoral major muscle in squabs was not affected by zinc supplementation in our experiment. Our finding is consistent with Qudsieh et al. (2018), who found that zinc sulfate at the level of 120 or 240 mg zinc/kg diet had no effect on the meat color of broiler chickens. It is possible that the amount of zinc and sources added in the diet lead to different results. Interestingly, our results showed that a low level of zinc (30 mg/kg) in the diet could reduce the shear force of pigeon breast muscle. The lower shear force value indicates the higher meat tenderness and the meat was soft and juicy. However, we did not demonstrate the mechanism of a low level of zinc improved pigeon meat tenderness. A recent study indicated that the major determinants of meat tenderness are connective tissue and cross-links, myofibrillar integrity, sarcomere length, protein denaturation and intramuscular fat (Warner et al., 2022). Therefore, it is necessary to demonstrate whether zinc supplementation could improve pigeon meat tenderness through the above major determinants. In addition, Liu et al. (2011) found dietary supplementation of 90 mg/kg zinc decreased the shear force of thigh muscle and the drip loss of breast muscle in broiler chickens. A previous study showed that a high level of dietary zinc sulfate (88.87–267.87 mg/kg) improved the tenderness of duck breast muscle by decreasing the shear force (Wen et al., 2019). Meat tenderness could be affected by many external factors, such as feeding conditions, environment, species, age, gender and dietary factors, which may be the reason for the contradiction of results (Alvarez et al., 2022).
Muscle oxidation including lipid peroxidation and protein oxidation has a significant effect on poultry production and meat quality. Malondialdehyde is one of the most used markers of lipid peroxidation, which could indirectly reflect the cell damage (Mari et al., 2010). Members of the enzymatic antioxidant system and non-enzymatic defense system including T-AOC and SOD, play important roles in protecting the organism from oxidative damage (Mishra and Jha, 2019). Zinc is a co-factor of cytosolic and extracellular Cu-Zn SOD, which has an important function in the detoxification of superoxide free radicals and protection of cells against oxidative stress by catalyzing the conversion of super oxide anion (O2−) to H2O2 (Yu et al., 2020). Different sources and levels of dietary zinc had significant impacts on the antioxidant status of broiler chickens (Dukare et al., 2021). Maternal supplementation of zinc glycine at the level of 80 mg/kg decreased the MDA level and increased T-SOD, Cu-Zn SOD, and T-AOC levels in the liver of chick embryos and 1-day-old chicks (Zhang et al., 2018). It indicated that the appropriate maternal zinc nutrition could be transferred from the feed to the egg, embryo and early offspring, participating in redox balance maintenance and antioxidant defenses. Our present study showed the similar results; adding zinc at the level of 120 mg/kg in breeding pigeons diet had the highest levels of T-AOC and Cu-Zn SOD and the lowest level of MDA in liver and breast muscle of squabs, indicating that dietary supplementation of 120 mg/kg zinc could decrease lipid peroxidation and increase antioxidant enzyme activities.
Additionally, it should be noted that the data in present study were not suitable for the evaluation of the dietary zinc requirement of breeding pigeons. Mayer et al. (2019) found that the zinc requirement of broiler breeders was obtained by the regression analyses based on the data of egg production, eggshell thickness and tibia breaking strength. The possible reasons were that our data including the Cu-Zn SOD, T-AOC and MDA contents were obtained from squabs not breeding pigeons. Therefore, we should estimate the zinc requirement with the data from breeding pigeons in future study.
In conclusion, dietary zinc supplementation of 120 mg/kg for breeding pigeons could increase the body weight and the breast muscle yield of squabs, which may be regulated by the antioxidant capacity and MyF6 mRNA expression of myogenic determinants family. Therefore, in order to improve the carcass traits of squabs, it is suggested that zinc could be supplemented in the diet up to 120 mg/kg for breeding pigeons.
Acknowledgments
ACKNOWLEDGMENTS
This study was funded by the Reform and development project of Beijing Academy of Agriculture and Forestry Science under Grant [number: XMS202315] and the Innovation capacity building project of Beijing Academy of Agriculture and Forestry Science under Grant [number: KJCX 20200404].
Authors contributions: Y.X.S and Y.Y.W conducted the experiments and drafted the manuscript; X.L, D.D.Z and J.L analyzed the sample; S.Z.Q, and Z.G.S processed the data; Z.W designed the experiment and edited the manuscript.
Data availability statement: The dataset analyzed in the current study is available from the corresponding author upon reasonable request.
DISCLOSURES
The authors declare no conflicts of interest.
Footnotes
Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2023.102809.
Appendix. Supplementary materials
REFERENCES
- Alian H.A., Samy H.M., Ibrahim M.T., Yusuf M.S., Mahmoud M.M.A. Nano zinc oxide improves performance, IGF-I mRNA expression, meat quality, and humeral immune response and alleviates oxidative stress and NF-κB immunohistochemistry of broiler chickens. Biol. Trace. Elem Res. 2023;201:4062–4078. doi: 10.1007/s12011-022-03494-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alvarez C., Koolman L., Whelan M., Moloney A. Effect of pre-slaughter practises and early post-mortem interventions on sheep meat tenderness and its impact on microbial status. Foods. 2022;11:181. doi: 10.3390/foods11020181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bao Y.M., Choct M., Iji P.A., Bruerton K. Trace mineral interactions in broiler chicken diets. Br. Poult. Sci. 2010;51:109–117. doi: 10.1080/00071660903571904. [DOI] [PubMed] [Google Scholar]
- Benzie I.F., Strain J.J. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Anal. Biochem. 1996;239:70–76. doi: 10.1006/abio.1996.0292. [DOI] [PubMed] [Google Scholar]
- Brambila G.S., Bowker B.C., Chatterjee D., Zhuang H. Descriptive texture analyses of broiler breast fillets with the wooden breast condition stored at 4°C and -20°C. Poult. Sci. 2018;97:1762–1767. doi: 10.3382/ps/pew327. [DOI] [PubMed] [Google Scholar]
- Chen M., Fu Z., Jiang S., Wang X., Yan H., Gao C. Targeted disruption of torc1 retards young squab growth by inhibiting the synthesis of crop milk protein in breeding pigeon (Columba Livia) Poult. Sci. 2020;99:416–422. doi: 10.3382/ps/pez513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Christensen L. Drip loss sampling in porcine m. longissimus dorsi. Meat. Sci. 2003;63:469–477. doi: 10.1016/s0309-1740(02)00106-7. [DOI] [PubMed] [Google Scholar]
- Davies J.L., Andrews G.S., Miller R., Owen H.G. Comparison of the stannous chloride and vanadate methods for estimation of serum inorganic phosphorus by use of the “SMA12-60. Clin. Chem. 1973;19:411–414. [PubMed] [Google Scholar]
- Dukare S., Mir N., Mandal A., Dev K., Begum J., Rokade J., Biswas A., Tyagi P., Tyagi P.K., Bhanja K. A comparative study on the antioxidant status, meat quality, and mineral deposition in broiler chicken fed dietary nano zinc viz-a-viz inorganic zinc. J. Food. Sci. Technol. 2021;58:834–843. doi: 10.1007/s13197-020-04597-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao J., Lv Z.P., Li C.W., Yue Y.S., Zhao X., Wang F., Guo Y.M. Maternal zinc supplementation enhanced skeletal muscle development through increasing protein synthesis and inhibiting protein degradation of their offspring. Biol. Trace. Elem Res. 2014;162:309-316. 5. doi: 10.1007/s12011-014-0122-5. [DOI] [PubMed] [Google Scholar]
- Huang Y.L., Yang J., Xiao F., Lloyd K., Lin X. Effects of supplemental chromium source and concentration on growth performance, carcass traits, and meat quality of broilers under heat stress conditions. Biol. Trace. Elem Res. 2016;170:216–223. doi: 10.1007/s12011-015-0443-z. [DOI] [PubMed] [Google Scholar]
- Jahanian R., Rasouli E. Effects of dietary substitution of zinc-methionine for Inorganic zinc sources on growth performance, tissue zinc accumulation and some blood parameters in broiler chicks. J. Anim. Physiol. Anim. Nutr (Berl). 2015;99:50–58. doi: 10.1111/jpn.12213. [DOI] [PubMed] [Google Scholar]
- Ji F., Zhang D.Y., Shao Y.X., Yu X.H., Liu X.Y., Shan D.C., Wang Z. Changes in the diversity and composition of gut microbiota in pigeon squabs infected with trichomonas gallinae. Sci. Rep. 2020;10:19978. doi: 10.1038/s41598-020-76821-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kamely M., Karimi torshizi M., Rahimi S. Blood biochemistry, thyroid hormones, and performance in broilers with ascites caused by caffeine. Poult. Sci. 2016;95:2673–2678. doi: 10.3382/ps/pew227. [DOI] [PubMed] [Google Scholar]
- Khajeh bami M., Afsharmanesh M., Ebrahimnejad H. Effect of dietary bacillus coagulans and different forms of zinc on performance, intestinal microbiota, carcass and meat quality of broiler chickens. Probiotics. Antimicrob. Proteins. 2020;12:461–472. doi: 10.1007/s12602-019-09558-1. [DOI] [PubMed] [Google Scholar]
- Kim H., Kang H. Effects of in ovo injection of zinc or diet supplementation of zinc on performance, serum biochemical profiles, and meat quality in broilers. Animal. 2022;12:630. doi: 10.3390/ani12050630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kwiecien M., Winiarska-mieczan A., Milczarek A., Klebaniuk R. Biological response of broiler chickens to decreasing dietary inclusion levels of zinc glycine chelate. Biol. Trace. Elem Res. 2017;175:204–213. doi: 10.1007/s12011-016-0743-y. [DOI] [PubMed] [Google Scholar]
- Lazure F., Blackburn D., Corchado A., Sahinyan K., Karam N., Sharanek A., Nguyen D., Lepper C., Najafabadi H.S., Perkins T., Jahani-Asl A., Soleimani V.D. Myf6/Myf4 is a myogenic niche regulator required for the maintenance of the muscle stem cell pool. Embo. Rep. 2020;21:e49499. doi: 10.15252/embr.201949499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li F., Yang C.X., Xie Y.J., Gao X., Zhang Y.Y., Ning H.Y., Liu G.T., Chen Z.H., Shan A.S. Maternal nutrition altered embryonic Myod1, Myf5 and Myf6 gene expression in genetically fat and lean lines of chickens. Anim. Biosci. 2022;35:1223–1234. doi: 10.5713/ab.21.0521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Z.H., Lu L., Li S.F., Zhang L.Y., Xi L., Zhang K.Y., Luo X.G. Effects of supplemental zinc source and level on growth performance, carcass traits, and meat quality of broilers. Poult. Sci. 2011;98:923–931. doi: 10.3382/ps.2010-01215. [DOI] [PubMed] [Google Scholar]
- Liu Z.H., Lu L., Wang R.L., Lei H., Li S.F., Zhang L.Y., Luo X.G. Effects of supplemental zinc source and level on antioxidant ability and fat metabolism-related enzymes of broilers. Poult. Sci. 2015;94:2686–2694. doi: 10.3382/ps/pev251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mahdy M. Comparative morphological study of the oropharyngeal floor of squabs and adult domestic pigeons (Columba Livia Domestica) Micros. Res. Tech. 2021;84:499–511. doi: 10.1002/jemt.23606. [DOI] [PubMed] [Google Scholar]
- Mari M., Colell A., Morales A., Von Montfort C., Garcia-Ruiz C., Fernández-Checa J.C. Redox control of liver function in health and disease. Antioxid Redox Signal. 2010;12:1295–1331. doi: 10.1089/ars.2009.2634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mayer A.N, Vieira S.L., Berwanger E., Angel C.R., Kindlein L., França I., Noetzold T.L. Zinc requirements of broiler breeder hens. Poult. Sci. 2019;98:1288–1301. doi: 10.3382/ps/pey451. [DOI] [PubMed] [Google Scholar]
- McCormick P.G. Titration of calcium and magnesium in milk with EDTA. J. Chem. Educ. 1973;50:136–137. doi: 10.1021/ed050p136. [DOI] [PubMed] [Google Scholar]
- Mishra B., Jha R. Oxidative stress in the poultry gut: potential challenges and interventions. Front. Vet. Sci. 2019;6:66. doi: 10.3389/fvets.2019.00060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogbuewu I.P., Mbajiorgu C.A. Potentials of dietary zinc supplementation in improving growth performance, health status, and meat quality of broiler chickens. Biol. Trace. Elem Res. 2022;4:1418–1431. doi: 10.1007/s12011-022-03223-5. [DOI] [PubMed] [Google Scholar]
- Oteiza P. Zinc and the modulation of redox homeostasis. Free. Radic. Biol. Med. 2012;53:1748–1759. doi: 10.1016/j.freeradbiomed.2012.08.568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pomianowski J., Mikulski D., Pudyszak K., Cooper R., Angowski M., Jozwik A., Horbanczuk J. Chemical composition, cholesterol content, and fatty acid profile of pigeon meat as influenced by meat-type breeds. Poult. Sci. 2009;88:1306–1309. doi: 10.3382/ps.2008-00217. [DOI] [PubMed] [Google Scholar]
- Qin Z., Caruso J., Lai B., Matusch A., Becker J. Trace metal imaging with high spatial resolution: applications in biomedicine. Metallomics. 2011;3:28–37. doi: 10.1039/c0mt00048e. [DOI] [PubMed] [Google Scholar]
- Qudsieh R .I., Smith D.P., Brake J. Effect of elevated dietary inorganic zinc on live performance, carcass yield, and quality of male and female broilers. Poult. Sci. 2018;97:4122–4130. doi: 10.3382/ps/pey274. [DOI] [PubMed] [Google Scholar]
- Salek P., Przybylski W., Jaworska D., Adamczak L., Zielinska D., Głuchowski A. The effects on the quality of poultry meat of supplementing feed with zinc-methionine complex. Acta. Sci. Pol. Technol. Aliment. 2020;19:73–82. doi: 10.17306/J.AFS.0756. [DOI] [PubMed] [Google Scholar]
- Savaris V.D.L., Broch J., De souza C., Rohloff Junior N., De Avila A.S., Polese C., Kaufmann C., De Oliveira Carvalho P.L., Pozza P.C., Vieites F., Nunes R.V. Effects of vitamin A on carcass and meat quality of broilers. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shao Y.X., Ma W.H., Ji F., Sun X.S., Du S.H., Li X., Li Q.F., Wang Z. Exploration of proteomics analysis of crop milk in pigeons (Columba Livia) during the lactation period. Acs. Omega. 2021;6:27726–27736. doi: 10.1021/acsomega.1c02977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Surai P.F., Kochish I.I., Fisinin V.I., Kidd M.T. Antioxidant defence systems and oxidative stress in poultry biology: an update. Antioxidants (Basel) 2019;8:235. doi: 10.3390/antiox8070235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z., Li X., Du S.H., Sun X.S., Huang J.G., Shao Y.X. Protective effects of zinc on Salmonella invasion, intestinal morphology and immune response of young pigeons infected with salmonella enterica serovar typhimurium. Biol. Trace. Elem Res. 2022;200:4817–4827. doi: 10.1007/s12011-021-03057-7. [DOI] [PubMed] [Google Scholar]
- Warner R.D., Wheeler T.L., Ha M., Li X., Bekhit A.E., Morton J., Vaskoska R., Dunshea F.R., Liu R., Purslow P., Zhang W. Meat tenderness: advances in biology, biochemistry, molecular mechanisms and new technologies. Meat Sci. 2022;185 doi: 10.1016/j.meatsci.2021.108657. [DOI] [PubMed] [Google Scholar]
- Wen M., Wu B., Zhao H., Liu G.M., Chen X.L., Tian G., Cai J., Jia G. Effects of dietary zinc on carcass traits, meat quality, antioxidant status, and tissue zinc accumulation of Pekin ducks. Biol. Trace. Elem Res. 2019;190:187–196. doi: 10.1007/s12011-018-1534-4. [DOI] [PubMed] [Google Scholar]
- Winiarska-mieczan A., Kwiecien M., Mieczan T., Kwiatkowska K., Jachimowicz K. The effect of Cu, Zn and Fe chelates on the antioxidative status of thigh meat of broiler chickens. Animal. 2021;15 doi: 10.1016/j.animal.2021.100367. [DOI] [PubMed] [Google Scholar]
- Ye M., Xu M., Chen C., He Y., Ding M., Ding X., Wei W., Yang S., Zhou B. Expression analyses of candidate genes related to meat quality traits in squabs from two breeds of meat-type pigeon. J. Anim. Physiol. Anim. Nutr (Berl). 2018;102:727–735. doi: 10.1111/jpn.12869. [DOI] [PubMed] [Google Scholar]
- Yu Q.F., Liu H., Yang K.L., Tang X.P., Chen S.J., Ajuwon K.M., Degen A., Fang R.J. Effect of the level and source of supplementary dietary zinc on egg production, quality, and zinc content and on serum antioxidant parameters and zinc concentration in laying hens. Poult. Sci. 2020;99:6233–6238. doi: 10.1016/j.psj.2020.06.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y.Y., Liu Y.S., Li J.L., Xing T., Jiang Y., Zhang L., Gao F. Dietary corn-resistant starch suppresses broiler abdominal fat deposition associated with the reduced cecal Firmicutes. Poult. Sci. 2020;9:5827–5837. doi: 10.1016/j.psj.2020.07.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang H.B., Wan M., Wang Z.S., Zhou A.M., Zhang X.M., Dong X.W., Peng Q.H. Supplementation dietary zinc levels on growth performance, carcass traits, and intramuscular fat deposition in weaned piglets. Biol. Trace. Elem. Res. 2014;161:69–77. doi: 10.1007/s12011-014-0078-5. [DOI] [PubMed] [Google Scholar]
- Zhang L., Wang J.S., Wang Q., Li K.X., Guo T.Y., Xiao X., Wang Y.X., Zhan X.A. Effects of maternal zinc glycine on mortality, zinc concentration, and antioxidant status in a developing embryo and 1-day-old chick. Biol. Trace. Elem. Res. 2018;181:323–330. doi: 10.1007/s12011-017-1028-9. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.


