TABLE 1.

Oligonucleotides used for the sia specific PCRs

Oligo- nucleotide	Sequence (5′-3′)	Target	Positiona	Reference
SH39	ATATCATTAGCATCTACC	siaA	864–881b	9, 10
UE16	CGGACAACAGTTCTCCT	siaC	2916–2900b	9, 10
UE12	CGCCTTTGCATCTGTCGTAGC	siaC	2861–2881b	12
UE13	GGAGATCAGAAGTCATAGTA	siaD downstream region (serogroup B)	4641–4622b	12
HC2	AAATCTATAAATTGACTC	siaC-siaD intergenic region (serogroup C)	94–75 ntc upstream of siaDd	23
HC4	GGAGATTTGTTTAGCT	siaD downstream region (serogroup C)	552–537 nt downstream of siaD	Unpublished
B/CsiaD1	AYATWTTGCATGTMSCYTTYCCTGA	siaD (serogroups B and C)	3702–3726b; 572–596d	6
B/CsiaD2	AGACATTGGGTWGWRGGKGARAGTAA	siaD (serogroups B and C)	4161–4136b; 1031–1006d	6
HC39	GTGTATGATATTCCAATC	siaD (serogroup W135)	1103–1124e	9
HC44	GGTTATATATTTCTAGA	siaD (serogroup Y)	1079–1095f	9
HC50	GGACAGTGGTGAGCTTTG	siaD downstream region (serogroups W135 and Y)	250–233 nt (W135) and 967–950 nt (Y) downstream of the siaD stop codon	Unpublished

^aNucleotide positions are according to the numbering of the published sequences indicated in footnotes b, d, e, and f. 

^bEMBL accession no. M95053. 

^cnt, nucleotides. 

^dGenBank accession no. U75650. 

^eEMBL accession no. Y13970. 

^fEMBL accession no. Y13969.