Skip to main content
Microbes and Environments logoLink to Microbes and Environments
. 2023 Sep 14;38(3):ME23034. doi: 10.1264/jsme2.ME23034

Mating Types of Ustilago esculenta Infecting Zizania latifolia Cultivars in Japan Are Biased towards MAT-2 and MAT-3

Yuka Chigira 1, Nobumitsu Sasaki 1,2,3,*, Ken Komatsu 1,3, Kouji Mashimo 4, Shigeyuki Tanaka 5, Minori Numamoto 5, Hiromitsu Moriyama 1, Takashi Motobayashi 1
PMCID: PMC10522849  PMID: 37704449

Abstract

Zizania latifolia cultivars infected by the endophytic fungus Ustilago esculenta develop an edible stem gall. Stem gall development varies among cultivars and individuals and may be affected by the strain of U. esculenta. To isolate haploids from two Z. latifolia cultivars in our paddy fields, Shirakawa and Ittenkou, we herein performed the sporadic isolation of U. esculenta strains from stem gall tissue, a PCR-based assessment of the mating type, and in vitro mating experiments. As a result, we obtained heterogametic strains of MAT-2 and MAT-3 as well as MAT-2, but not MAT-3, haploid strains. Another isolation method, in which we examined poorly growing small clusters of sporidia derived from teliospores, succeeded in isolating a MAT-3 haploid strain. We also identified the mating types of 10 U. esculenta strains collected as genetic resources from different areas in Japan. All strains, except for one MAT-1 haploid strain, were classified as MAT-2 haploid strains or heterogametic strains of MAT-2 and MAT-3. The isolated strains of MAT-1, MAT-2, and MAT-3 mated with each other to produce hyphae. Collectively, these results indicate that the mating types of U. esculenta infecting Z. latifolia cultivars in Japan are biased towards MAT-2 and MAT-3 and that U. esculenta populations in these Japanese cultivars may be characterized by the low isolation efficiency of the MAT-3 haploid.

Keywords: Ustilago esculenta, Zizania latifolia, makomotake, mating type, haploid isolation


Zizania latifolia, known as Manchurian wild rice, is a perennial aquatic grass belonging to the genus Zizania in the family Gramineae and is distributed in East and Southeast Asia, including Japan. In agriculture, Z. latifolia is cultivated as a vegetable in many Asian countries because its varieties infected by the endophytic fungus Ustilago esculenta develop an edible stem gall, known as “jiaobai” in China (Zhang et al., 2017), “kamborg” in India (Jose et al., 2016), and “makomotake” in Japan (Kawagishi et al., 2006). Infection by this smut fungus prevents inflorescence development and seed production by the plant. Instead, the hyphae and mycelia of the fungus spread throughout culm tissue near the apical meristem of young culms, causing a swollen stem gall (Yang and Leu, 1978; Zhang et al., 2012). During gall formation, large hyphal aggregates produce the sori forming mature teliospores (Yang and Leu, 1978). White stem galls with less sori are edible and a more valuable vegetable than gray-to-brown galls full of sori. The efficiency of sorus formation varies depending on the strain of U. esculenta.

A mycelial-teliospore (M-T) strain and teliospore (T) strain of U. esculenta have been isolated and characterized in detail in China (Yang and Leu, 1978; You et al., 2011, Zhang et al., 2017; Liang et al., 2019). The infection of Z. latifolia with M-T strains results in the formation of edible white stem galls (called white jiaobai) because no sori are formed at the harvesting stage. On the other hand, T strains develop sori at the early stage of stem gall formation. Mature stem galls filled with sori (called gray jiaobai) are not edible. M-T strains show lower rates of teliospore germination and hyphal growth, require different nutrients in medium for growth, and are more sensitive to external signals, such as H2O2 and pH, than T strains (Zhang et al., 2017). In addition, M-T strains, which are more endophytic than T strains, have multiple mutated genes related to pathogenicity (Zhang et al., 2017).

U. esculenta is a bipolar heterothallic fungus with three mating-type loci: MAT-1, MAT-2, and MAT-3 (Liang et al., 2019). Sporidia that develop from the teliospore multiply asexually through repeated budding. Each sporidium is a haploid carrying the MAT-1, MAT-2, or MAT-3 locus. Mating occurs when two conjugation tubes of haploids with different mating types fuse together, producing dikaryotic hyphae. By characterizing the mating types of M-T and T strains, the MAT locus-related genes involved in the initial step of mating between sexually compatible strains and the later steps of hyphal growth and invasion after mating have been identified (Zhang et al., 2019), such as the a locus genes for pheromones (mfa) and pheromone receptors (pra) and the b locus genes for homeodomain proteins (bE and bW). The mfa pheromone and pra receptor proteins are necessary for the recognition of compatible haploid sporidia (Kellner et al., 2011). bE and bW are subunits of the heterodimeric transcription factor responsible for hyphal formation, elongation, and invasion after mating (Wahl et al., 2010).

In Japan, Z. latifolia cultivars producing edible makomotake are expected to be cultivated in fallow rice fields (Anazawa et al., 2007) for the following reasons: (1) there is no need to invest in new agricultural machinery because machines for rice fields may be used, (2) its planting and harvesting seasons are different from those of rice paddy fields, and (3) its economic value is higher than that of rice cultivation. Z. Latifolia cultivars in Japan are divided into two types: early maturing cultivars, such as Ittenkou, which form the stem gall from mid-September, and late maturing cultivars, such as Shirakawa, which form the stem gall later. Regardless of the type of cultivar, we often find individual plants that develop the stem gall much later than the harvest season and call these the “delayed type” to distinguish them from the “normal type”. These variations in the timing of stem gall formation result in the inefficient production of makomotake. To improve the productivity of makomotake, it is important to identify the cause of variations in the timing of stem gall formation between individual plants. As described above, the different characteristics of U. esculenta strains may have different effects on the development of the stem gall. However, limited information is currently available on U. esculenta strains infecting Japanese Z. latifolia cultivars used for the production of edible makomotake. Therefore, the isolation of U. esculenta haploid strains that infect Japanese Z. latifolia cultivars and the establishment of an experimental infection system using mating pairs between isolated haploids are needed. We herein obtained haploid strains of U. esculenta from Z. latifolia cultivated in our paddy fields and in different areas of Japan and identified their mating types by genomic PCR and in vitro mating experiments.

Materials and Methods

Isolation of U. esculenta strains from the stem gall tissue of Z. latifolia

Z. latifolia plants with the stem gall (cvs. Ittenkou and Shirakawa; Supplementary Fig. S1), which were cultivated in 2019 at the paddy fields of Tokyo University of Agriculture and Technology (Honmachi, Fuchu, Tokyo), were collected. After the leaf sheaths around the stem gall were removed, the surface of the stem gall was wiped with 70% ethanol. Internal stem tissue was cut out‍ ‍on a clean bench using flame-sterilized tweezers and razor blades. Excised tissues were incubated on potato dextrose agar (PDA) containing chloramphenicol (0.05‍ ‍g‍ ‍L–1) and streptomycin (0.1‍ ‍g‍ ‍L–1) at 28°C for 10–15 days. Colonies that formed around the excised tissues on PDA were transferred onto new PDA and incubated at 28°C. Each colony was suspended in sterile RO water, placed on PDA, and incubated at 28°C. Well-grown single colonies were saved individually and used for characterization. To examine the formation of aerial hyphae, colonies were transferred to YEPS agar medium containing sucrose (20‍ ‍g‍ ‍L–1), tryptone (20‍ ‍g‍ ‍L–1), yeast extract (10‍ ‍g‍ ‍L–1), activated charcoal (10‍ ‍g‍ ‍L–1), and agar (15‍ ‍g‍ ‍L–1) and incubated at 28°C.

In vitro mating experiment

Strains of U. esculenta from yeast-like colonies were cultured separately on YEPS agar medium at 28°C. Clumps of each strain that formed on the medium were scraped with a sterile toothpick and resuspended in YEPS liquid medium to an OD600 of approximately 1.5. In in vitro mating experiments, pairs of selected strains were mixed at a ratio of 1:1, and approximately 30‍ ‍μL of the mixture was dropped onto YEPS agar medium. YEPS agar media were kept at 28°C for more than 2‍ ‍weeks.

DNA isolation and PCR

DNA isolation and PCR were performed to confirm that the isolated strains were U. esculenta and identify their mating types. Isolates were cultured on YEPS agar or PDA medium and a clump of approximately 3‍ ‍mm in diameter was scraped from each medium with a disposable inoculation loop and collected in a 2.0-mL tube. These tubes were frozen at –30°C until used. Six hundred microliters of TE with 50% (w/v) Chelex-100 (Bio-Rad Laboratories) and 200‍ ‍μL of chloroform were added to the fungal clumps. Clumps were homogenized with a Mini Bead-Beater (WakenBtech) at 4,800‍ ‍rpm for 1‍ ‍min. After centrifugation at 20,400×g for 10‍ ‍min, 150‍ ‍μL of the supernatant was collected and an equal volume of chloroform was added and vortexed well. After centrifugation at 20,400×g for 5‍ ‍min, 100‍ ‍μL of the supernatant was used as the DNA extract.

Genomic PCR was performed using the Ex Taq Hot Start Version kit (TaKaRa Bio), the primers listed in Table 1, and TaKaRa PCR Thermal Cycler Dice (TaKaRa Bio). Thirty cycles of PCR were conducted under the following conditions according to the manufacturer’s instructions: denaturation at 98°C for 10‍ ‍s, annealing at 50°C for 30‍ ‍s, and elongation at 72°C for 50 s. PCR products were electrophoresed on 1% agarose gel with TAE buffer, stained with ethidium bromide, and visualized with a Gel-Doc RX+ imaging system (Bio-Rad Laboratories).

Table 1.

Primers used in this study1

Gene Forward Forward primer (5'→3') Reverse Reverse primer (5'→3') Expected DNA
size (bp)
pra1 pra1/F ATCGGCATCCTCGCTCATTATG pra1/R TGCATGCTTGATCTCCGTTGCG 618
pra2 pra2/F ACAGCATGTCTTCCCACCTTTTC pra2/R GACAAAGCAGCAGTGAACTGCC 606
pra3 pra3/F CACAATTCCCATCACGGTGCTC pra3/R GAGCGAGAGCACTGATGGAAAG 582
mfa1.2 mfa1.2/F CACAATGCCCTTTATCTGATGG mfa1.2/R GTTGTGGTCAGGCTAACTAGGG 389
mfa2.1 mfa2.1/F CATCTCGAGTAACCCCTGAACA mfa2.1/R GAGATAATCAAAGGTGGGCGGG 498
mfa3.2 maf3.2/F CAGTAGCACCTGTCTTCCTC maf3.2/R ACGCAAGTCGAGTAGCCGAGAG 331
bW1 bW1/F CAAATCCAATCCATGGTAGCCG bW1/R CTGACAGCCGTAATCGAAGTTG 458
bW2 bW2/F CAAGAATGTTCACGCCTTAGCC bW2/R CTTGTACCATTCGAGTGGATGC 452
bW3 bW3/F CAGCACTTCTCCTCTTGTCGAG bW3/R TGATCAGCAGAGACATCGAGAG 480
bE1 bE1/F CAACTCCTCGAACTACTCACTG bE1/R CGTCCAACTTGTGAGTCAGAAC 622
bE2 bE2/F GGAACTAAGCAAGCCTTTTCGG bE2/R TCCAGTGCGGATAGGAATGTTG 627
bE3 bE3/F ACCTTCTCCTTCGCCGATTTAC bE3/R TTCAGAACTGAGGGAAGAGGTC 632
ITS2/28S rRNA UeITS2/F AAGACGGACGAAAGCTTGAA Ue28SrRNA/R AATCCCAGGCCGCATCTCT 625

1 Primer sequences were adapted from Zhang et al. (2017) and Tu et al. (2019), except for those for pra2/F, maf3.2/F, and UeITS/F. The primers of pra2/F, maf3.2/F, and UeITS2/F were designed based on GenBank accession sequences KT343777.1, KT343769.1, and AB211904.1, respectively.

Isolation of the MAT-3 haploid strain from U. esculenta teliospores

Teliospores in the stem gall of a Z. latifolia plant cultivated in 2021 were scraped off with an autoclaved toothpick, suspended in 100‍ ‍μL of sterile RO water to make a teliospore suspension, and then diluted 10-fold with sterile RO water. Ten microliters of the diluted suspension was dropped onto the periphery of PDA medium and flowed in a straight line with the medium tilted. Six plates of PDA medium were prepared in the same manner. After being incubated at 28°C for 6 days, 107 small colonies were picked up with the tip of an ethanol-sterilized sewing needle under an Olympus SZX9 stereomicroscope (Olympus) and transferred onto the same PDA and new YEPS agar (without active charcoal) media at intervals of approximately 1‍ ‍cm. After being incubated at 28°C for 7 or 8 days, the diameter of each colony was measured with a ruler or, if colony formation was invisible, the growth of sporidia was examined under the stereomicroscope. Strains with a maximum diameter ≤2‍ ‍mm and without mycelial growth were selected for the mating-type ana­lysis. Visually confirmed colonies were scraped off and inoculated into YEPS (without active charcoal) liquid medium. When strains growing sporidia were confirmed by the stereomicroscope only, their colonies were cut out together with agar medium and inoculated to YEPS (without active charcoal) liquid medium. YEPS liquid media were incubated at 28°C and 180‍ ‍rpm with reciprocal shaking for 18 days (strains A12, A13, α20, α25, β11, and γ17) or 48 days (α1, β3, β8, and β9).

U. esculenta strains from the Genebank of the National Agriculture and Food Research Organization (NARO) Research Center of Genetic Resources

Strains of U. esculenta isolated from Z. latifolia plants produced in various areas of Japan (Nagano, Mie, Shiga, Okinawa, and Ibaraki) and China (the specific production area is unknown) were obtained from the NARO Genebank, the Research Center of Genetic Resources (https://www.gene.affrc.go.jp/index_en.php). MAFF numbers, strain names, and production areas are summarized in Table 4; however, the specific names of Z. latifolia cultivars are unavailable. Cultivation on PDA medium, mating assays, and genomic PCR of the strains were performed as described above.

Table 4.

Mating types of Ustilago esculenta strains from different production areas in Japan and China

MAFF ID Strain Production area (city) Mating type
241286 TY64 Nagano Pref. (Nagano) MAT-2
241684 TY65 Nagano Pref. (Nagano) MAT-2
305616 yeast4 China MAT-2, MAT-3
305618 MC-2 Mie Pref. MAT-2
305619 MJ-2 Shiga Pref. MAT-1
305620 IF-6 Okinawa Pref. MAT-2, MAT-3
305621 ON-3 Okinawa Pref. MAT-2
327436 J1 Ibaraki Pref. (Tsuchiura) MAT-2, MAT-3
327440 J5 Ibaraki Pref. (Tsuchiura) MAT-2
327443 J8 Ibaraki Pref. (Tsuchiura) MAT-2, MAT-3

Microscope observations

Yeast-like colonies, sporidia, mycelia, and teliospores were observed with an Olympus SZX9 stereomicroscope (Olympus) (for Fig. 1A, 2B and C, and 3), a Sony Cyber-shot DSC-HX5 camera (Sony) (for Fig. 1B), an Olympus BX50 biological microscope (Olympus) (for Fig. 2A), and a Keyence BZ-X800 all-in-one fluorescence microscope (Keyence) (for Fig. 1C).

Fig. 1.

Fig. 1.

Colony formation by Ustilago esculenta on PDA and YEPS agar media and PCR-based mating-type assays.

A and B. Yeast-like colonies of U. esculenta on PDA medium after an incubation at 28°C for 39 days (A). There were colonies of various sizes. These yeast-like colonies consisted of a U. esculenta population, which was isolated from the stem gall tissue of Zizania latifolia. Colonies of each strain with or without aerial hyphae cultured on YEPS agar medium, incubated at 28°C for 35 days after transfer from the PDA medium (B). C. We observed pseudohyphae (arrowhead) and sporidia (arrow) from a colony without aerial hyphae cultured on YEPS agar medium at 28°C for 13 days (bar=100‍ ‍μm). D and E. Genomic PCR was performed with DNA samples from a colony without (D) or with (E) aerial hyphae. In D, the PCR products of all MAT-2-associated genes (pra2, mfa2, bW2, and bE2) were amplified, while non-specific fragments of unexpected sizes were weakly amplified for other genes. In E, the PCR products of all MAT-2- and MAT-3-associated genes (pra2, pra3, mfa2, mfa3, bW2, bW3, bE2, and bE3) were amplified. In both samples, the PCR products of the precursor rRNA gene (rRNA) of U. esculenta was amplified. The expected sizes of PCR products are listed in Table 1.

Fig. 2.

Fig. 2.

Isolation of MAT-3 and MAT-1 haploid strains of Ustilago esculenta.

A. Teliospores from the stem gall of Zizania latifolia cv. Shirakawa. Bar=20‍ ‍μm. B. Colonies from teliospores on PDA medium after an incubation at 28°C for 6 days. Arrows indicate the colonies selected for the isolation of MAT3 haplotype strains. Bar=2‍ ‍mm. C. Teliospores that ceased hyphal growth on PDA medium after an incubation at 28°C for 5 days. The arrow indicates a colony that continued to grow. Some teliospores did not develop sporidia from the promycelium (blue arrowheads) and others appeared to have stopped forming sporidia sometime after budding (red arrowheads). Bar=20‍ ‍μm. D and E. Mating-type assays of the MAT-3 (D) and MAT-1 (E) haploid strains by genomic PCR. The PCR products of MAT-3-associated genes (pra3, mfa3, bW3, and bE3) and MAT-1-associated genes (pra1, mfa1, bW1, and bE1) were amplified specifically for strain α1 and strain MJ-2, respectively. The precursor rRNA gene (rRNA) of Ustilago esculenta was amplified for both strains. The expected sizes of PCR products are listed in Table 1.

Fig. 3.

Fig. 3.

Morphology of colonies formed in the in vitro mating experiment using three different mating-type strains.

Sporidia of three strains alone (MAT-1, MAT-2, and MAT-3) or a combination of two strains (MAT-1×MAT-2, MAT-2×MAT-3, and MAT-3×MAT-1) were grown on YEPS agar medium at 28°C. Images were captured after a 14-day incubation. MAT-1=strain MJ-2; MAT-2=strain Sn-1-(1)-F1; MAT-3=strain α1. Bar=1‍ ‍mm.

Results

Isolation of haploid strains of U. esculenta from the stem gall tissue of Z. latifolia

To characterize U. esculenta infecting Z. latifolia plants (cvs. Ittenkou and Shirakawa) grown in our paddy fields, we attempted to isolate haploid strains from the stem gall: four stem galls from Ittenkou (I-1 to I-4 for the normal type only) and four stem galls from Shirakawa plants (two normal types named Sn-1 and Sn-2 and two delayed types named Sd-2 and Sd-3). We selected whitish yeast-like colonies on PDA medium, which were previously shown to be characteristic of U. esculenta (Zhang et al., 2020). These original colonies were numbered in parentheses (e.g., I-1-(1)) when obtained from different parts of the same stem gall (Table 2). Suspensions of these original colonies were repeatedly transferred to PDA medium. Among colonies of various sizes grown on PDA medium (Fig. 1A), well-grown single colonies were selected for transfer to YEPS agar medium containing activated charcoal, which promotes hyphal growth by mating (Rodríguez-Kessler et al., 2012). Through attempts to isolate haploid strains, we found that there were colonies with or without aerial hyphae (Fig. 1B). Regarding the colony with aerial hyphae where two haploid strains may be mixed, approximately 20 days (for Shirakawa) or 15 days (for Ittenkou) were generally needed before aerial hyphae were observed visually on the colony. Isolated strains selected from several colonies were named with letters (e.g., I-1-(1)-A). In addition, to completely isolate haploid cells, we obtained passage cultures of Sn-1-(1)-B and F, which showed aerial hyphal formation. As a result, progeny strains that did not form aerial hyphae in the colony were successfully isolated (i.e., Sn-1-(1)-B2b, F1, and F2) (Table 2). These colonies without aerial hyphae formed pseudohyphae containing aerial cell chains and producing sporidia (Fig. 1C).

Table 2.

Hyphal formation and mating types of strains isolated from the stem gall tissue of Ittenkou and Shirakawa cultivars

Cultivar Strain Presence of
aerial hyphae
Mating type
Ittenkou
(normal type)
I-1-(1)-A MAT-2
I-1-(2)-A MAT-2
I-1-(2)-C MAT-2
I-2-(3)-A MAT-2
I-2-(3)-E MAT-2
I-3-(3)-A + MAT-2, MAT-3
I-3-(3)-B + MAT-2, MAT-3
I-3-(3)-C + MAT-2, MAT-3
I-4-(1)-A + MAT-2, MAT-3
I-4-(1)-B + MAT-2, MAT-3
Shirakawa
(normal type)
Sn-1-(1)-B1a + MAT-2, MAT-3
Sn-1-(1)-B1b + MAT-2, MAT-3
Sn-1-(1)-B1c + MAT-2, MAT-3
Sn-1-(1)-B2a + MAT-2, MAT-3
Sn-1-(1)-B2b MAT-2
Sn-1-(1)-F1 MAT-2
Sn-1-(1)-F2 MAT-2
Sn-1-(1)-F3 + MAT-2, MAT-3
Sn-1-(3)-C MAT-2
Sn-2-(2)-B MAT-2
Sn-2-(2)-D MAT-2
Sn-2-(2)-E MAT-2
Shirakawa
(delayed type)
Sd-2-(1)-A MAT-2
Sd-2-(1)-F MAT-2
Sd-3-(1)-B MAT-2
Sd-3-(1)-D1 MAT-2
Sd-3-(1)-D2 MAT-2
Sd-3-(1)-D3 MAT-2

To identify haploid mating pairs, in vitro mating experiments were performed with 18 putative haploid strains that did not form colonies with aerial hyphae (13 from Shirakawa and 5 from Ittenkou) (Table 2). However, all of the crossings between the selected haploid strains resulted in the formation of yeast-like colonies that never developed aerial hyphae (data not shown). This result suggests that all the haploid strains used for crossing had the same mating type. To identify the mating type of these haploid strains, genomic PCR was performed using MAT-associated genes (pra, mfa, bW, and bE) (Table 1). PCR results showed that all of the haploid strains contained pra, mfa, bW, and bE genes associated with MAT-2, but not MAT-1 or MAT-3 (Fig. 1D and Table 2). This result clearly indicated that all strains used for in vitro mating experiments were MAT-2. In addition, we performed genomic PCR for 10 other strains that formed colonies with aerial hyphae (5 each from Shirakawa and Ittenkou) to clarify their mating types. As a result, all of the non-haploid strains contained the genes associated with MAT-2 and MAT-3, but not MAT-1 (Fig. 1E and Table 2). These results indicate that the two cultivars, Ittenkou and Shirakawa, were infected with the U. esculenta population of MAT-2 and MAT-3 and also that MAT-2 haploids were more preferentially isolated than MAT-3 haploids.

Isolation of the MAT-3 haploid strain from poorly growing colonies from U. esculenta teliospores

Since the mating type of the haploid strains derived from well-grown colonies was only MAT-2, we hypothesized that the growth of MAT-3 haploid colonies was markedly slower than that of MAT-2 haploid colonies, resulting in MAT-3 haploid strains not being isolated. To obtain MAT-3 haploid strains, we observed colonies of the early progeny sporidia budded from teliospores that were collected from the stem gall of Shirakawa (normal type) (Fig. 2A). After an incubation for 6 days, we found a number of small colonies (sporidia clusters) of less than 0.5‍ ‍mm in diameter (Fig. 2B). Moreover, many teliospores developed no or a few sporidia from the promycelium (Fig. 2C), which is consistent with previous findings (You et al., 2011; Zhang et al., 2017). Among the 107 small colonies examined for colony formation, we obtained 10 strains that formed colonies or sporidial clusters of less than 2‍ ‍mm in diameter after an incubation for 7 to 8 days (Table 3). The amplification of the mating type-related genes of these 10 strains by genomic PCR revealed one haploid strain (named α1) of MAT-3, 5 haploid strains of MAT-2, and 4 heterogametic strains of MAT-2 and MAT-3 (Fig. 2D and Table 3). We accidentally detected the growth of strain α1 after a 48-days incubation, which was markedly longer than the time required for the growth of many other strains (18 days) (see Materials and Methods). These results support our hypothesis that MAT-3 haploid strains of U. esculenta in Shirakawa may grow more slowly than MAT-2 haploid strains.

Table 3.

Mating types of Ustilago esculenta strains with retarded sporidial growth

Strain Maximum diameter1
(visual observation)
Sporidial growth confirmed
with a stereomicroscope2
Mating type
PDA YEPS PDA YEPS
A12 2‍ ‍mm 2‍ ‍mm n.d. n.d. MAT-2
A13 2‍ ‍mm invisible n.d. + MAT-2
α1 1‍ ‍mm invisible n.d. MAT-3
α20 Invisible invisible + MAT-2, MAT-3
α25 Invisible invisible + + MAT-2, MAT-3
β3 Invisible invisible + + MAT-2, MAT-3
β8 1‍ ‍mm invisible n.d. + MAT-2
β9 1‍ ‍mm invisible n.d. + MAT-2
β11 2‍ ‍mm 0.5‍ ‍mm n.d. n.d. MAT-2
γ17 Invisible invisible + MAT-2, MAT-3

1 The maximum diameter of visually observable colonies was measured roughly with a ruler.

2 The presence (+) or absence (–) of sporidial growth was confirmed by observations under a stereomicroscope. n.d.=not determined.

Identification of mating types of U. esculenta strains collected from different areas in Japan

To investigate whether the predominance of MAT-2 and MAT-3 was limited to Shirakawa and Ittenkou, we also obtained 10 strains of U. esculenta, which are genetic resources collected from different areas of Japan (i.e., Nagano, Mie, Shiga, Okinawa, and Ibaraki Prefectures), and performed genomic PCR to investigate their mating types. One available strain from China was included in this experiment. As shown in Table 4, five strains from Nagano (TY64 and TY65), Mie (MC-2), Okinawa (ON-3), and Ibaraki (J5) were the MAT-2 haploid, while the remaining four strains from Okinawa (IF-6), Ibaraki (J1 and J8), and China (yeast4) were heterogametic strains of MAT-2 and MAT-3. Only one strain from Shiga (MJ-2) was the MAT-1 haploid (Fig. 2E and Table 4). These results suggest that Japanese cultivars of Z. latifolia are predominantly infected by the U. esculenta population with MAT-2 and MAT-3 mating types.

In vitro mating experiments using pairs of different mating types were conducted to confirm their mating ability. Strain MJ-2 and strain α1 were used as MAT-1 and MAT-3 haploid strains, respectively. One of the strains from Shirakawa, named Sn-1-(1)-F1, was used as the representative MAT-2 haploid strain. Sporidia of three strains (MAT-1, MAT-2, and MAT-3) alone formed yeast-like colonies (Fig. 3). On the other hand, the mating of two different strains resulted in the formation of colonies with aerial hyphae in‍ ‍all cases (MAT-1×MAT-2, MAT-2×MAT-3, and MAT-3×MAT-1) (Fig. 3). We also performed in vitro mating experiments using the MAT-2 haploid strain from Ittenkou, I-2-(3)-A, instead of Sn-1-(1)-F1. The results obtained confirmed that any combination of three different mating type strains led to hyphal development in their colonies (Supplementary Fig. S2). These results demonstrated the validity of our genomic PCR to identify haploid mating types.

Discussion

In the present study, we focused on isolating U. esculenta haploid strains from Ittenkou and Shirakawa cultivars in our paddy fields. The isolation of sporidia using stem gall tissue provided colonies with or without hyphal growth. Analyses to identify mating types revealed that the U. esculenta population in the two cultivars consisted of the heterogametic strains of MAT-2 and MAT-3, excluding MAT-1, regardless of the cultivars or the normal or delayed phenotypes. All strains from yeast-like colonies without hyphal formation were the MAT-2 mating type. This result indicates that MAT-2 haploids were easily isolated from normally growing colonies, while MAT-3 haploids were more difficult to be isolated in the same manner. Our attempt to isolate MAT-3 haploids from teliospore-derived, poorly growing colonies led to the isolation of strain α1. Except for strain α1, only MAT-2 haploid strains were isolated from tiny visible colonies. This result suggests that the sporidial growth of MAT-3 was slower than that of MAT-2 or ceased shortly after germination from the teliospore. Consequently, slow-growing MAT-3 haploids may have been buried by fast-growing MAT-2 haploids during colony formation. Although further ana­lyses of the growth of MAT-3 haploid strains are required, the different characteristics of sporidial growth between the two haploid types may explain why haploid isolation from stem gall tissue resulted in the occupation of only MAT-2 strains. Therefore, a more careful examination of small colonies is needed for the isolation of MAT-3 haploid strains.

We also identified the mating types of 10 strains of U. esculenta collected from various regions of Japan. Consistent with Shirakawa and Ittenkou, MAT-2 alone or the combination of MAT-2 and MAT-3 was detected in all strains, except for strain MJ-2. These results suggest that the combination of MAT-2 and MAT-3 is the predominant mating type of the U. esculenta population infecting Z. latifolia cultivars in Japan. In addition, no haploid strains of MAT-3 were identified from the U. esculenta collection, which provides support for the difficulties associated with isolating MAT-3 haploids from Japanese cultivars of Z. latifolia. Regarding the MJ-2 strain, which was the only MAT-1 haploid identified, its source was Z. latifolia with a blackish brown stem gall full of teliospores (Supplementary Fig. S3). Pure teliospores are used as a pigment called “makomozumi” in the lacquer industry in Japan, but may be a cause of hypersensitivity pneumonitis (Yoshida et al., 1996; Fujii et al., 2007). Therefore, the Z. latifolia cultivar carrying the MJ-2 strain may be for craft (“makomozumi” pigment use) rather than for food. Zhang et al. (2017) reported that the mating types of T strains from gray jiaobai, which is full of sori, were MAT-1 or MAT-2, while those of the M-T strain from white jiaobai were MAT-2 or MAT-3. Based on these findings, MAT-1 strains rather than MAT-2 and MAT-3 strains may play a dominant role in facilitating the development of teliospores and sori in the stem gall. On the other hand, the infection of Z. latifolia by MAT-2 and MAT-3 strains may be responsible for the M-T phenotype, which produces white edible galls with no or few sori.

In conclusion, the present results indicate that Japanese cultivars of Z. latifolia are infected by the U. esculenta strains of MAT-2 and MAT-3 mating types. To further clarify the relationship between stem gall formation and U. esculenta strains, it is important to isolate more MAT-3 strains from Shirakawa, Ittenkou, and other cultivars. As previously reported (Liang et al., 2019), the isolation of sporidia immediately after budding from teliospores using a micromanipulator is an effective method to isolate MAT-3 strains. Further characterization and comparative genomic ana­lyses of MAT-2 and MAT-3 strains infecting Z. latifolia cultivars in Japan will provide more information on the characteristics of U. esculenta, which will improve the productivity of makomotake.

Citation

Chigira, Y., Sasaki, N., Komatsu, K., Mashimo, K., Tanaka, S., Numamoto, M., et al. (2023) Mating Types of Ustilago esculenta Infecting Zizania latifolia Cultivars in Japan Are Biased towards MAT-2 and MAT-3. Microbes Environ 38: ME23034.

https://doi.org/10.1264/jsme2.ME23034

Supplementary Material

Acknowledgements

We acknowledge Dr. Toyozo Sato (Niigata Agro-Food University) for providing information on and images of Z. latifolia, from which the MJ-2 strain was isolated, and for useful discussions on this manuscript. We also thank the Institute of Global Innovation Research at Tokyo University of Agriculture and Technology (GIR-TUAT) for the Special Research Fund. This work was partly supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Numbers 26450052 and 19K06047 (to N.S.) and Grant Number 19K24688 (to S.T).

References

  1. Anazawa, T., Yoshida, T., and Kurita, H. (2007) Growth and yielding ability in wild rice. Jpn J Crop Sci 76: 52–58 (in Japanese). [Google Scholar]
  2. Fujii, Y., Konno, K., Atarashi, K., Ohtani, Y., Inase, N., Tanaka, T., and Yoshizawa, Y. (2007) A case of hypersensitivity pneumonitis caused by smut spores of Ustilago esculenta. J Jpn Respir Soc 45: 344–348 (in Japanese). [PubMed] [Google Scholar]
  3. Jose, R.C., Goyari, S., Louis, B., Waikhom, S.D., Handique. P.J., and Talukdar, N.C. (2016) Investigation on the biotrophic interaction of Ustilago esculenta on Zizania latifolia found in the indo-Burma biodiversity hotspot. Microb Pathog 98: 6–15. [DOI] [PubMed] [Google Scholar]
  4. Kawagishi, H., Hota, K., Masuda, K., Yamaguchi, K., Yazawa, K., Shibata, K., et al. (2006) Osteoclast-forming suppressive compounds from makomotake, Zizania latifolia infected with Ustilago esculenta. Biosci Biotechnol Biochem 70: 2800e2802. [DOI] [PubMed] [Google Scholar]
  5. Kellner, R., Vollmeister, E., Feldbrügge, M., and Begerow, D. (2011) Interspecific sex in grass smuts and the genetic diversity of their pheromone-receptor system. PLoS Genet 7: e1002436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Liang, S.W., Huang, Y.H., Chiu, J.Y., Tseng, H.W., Huang, J.H., and Shen, W.C. (2019) The smut fungus Ustilago esculenta has a bipolar mating system with three idiomorphs larger than 500‍ ‍kb. Fungal Genet Biol 126: 61–74. [DOI] [PubMed] [Google Scholar]
  7. Rodríguez-Kessler, M., Baeza-Montañez, L., García-Pedrajas, M.D., Tapia-Moreno, A., Gold, S., Jiménez-Bremont, J.F., and Ruiz-Herrera, J. (2012) Isolation of UmRrm75, a gene involved in dimorphism and virulence of Ustilago maydis. Microbiol Res 167: 270–282. [DOI] [PubMed] [Google Scholar]
  8. Tu, Z., Yamada, S., Hu, D., Ito, Y., Iwasaki, T., and Yamaguchi, A. (2019) Microbial diversity in the edible gall on white bamboo formed by the interaction between Ustilago esculenta and Zizania latifolia. Curr Microbiol 76: 824–834. [DOI] [PubMed] [Google Scholar]
  9. Wahl, R., Zahiri, A., and Kamper, J. (2010) The Ustilago maydis b mating type locus controls hyphal proliferation and expression of secreted virulence factors in planta. Mol Microbiol 75: 208–220. [DOI] [PubMed] [Google Scholar]
  10. Yang, H.C., and Leu, L.S. (1978) Formation and histopathology of galls induced by Ustilago esculenta in Zizania latifolia. Phytopathology 68: 1572–1576. [Google Scholar]
  11. Yoshida, K., Suga, M., Yamasaki, H., Nakamura, K., Sato, T., Kakishima, M., et al. (1996) Hypersensitivity pneumonitis induced by a smut fungus Ustilago esculenta. Thorax 51: 650–657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. You, W., Liu, Q.A., Zou, K.Q., Yu, X.P., Cui, H.F., and Ye, Z.H. (2011) Morphological and mole­cular differences in two strains of Ustilago esculenta. Curr Microbiol 62: 44–54. [DOI] [PubMed] [Google Scholar]
  13. Zhang, J.Z., Chu, F.Q., Guo, D.P., Hyde, K.D., and Xie, G.L. (2012) Cytology and ultrastructure of interactions between Ustilago esculenta and Zizania latifolia. Mycol Prog 11: 499–508. [Google Scholar]
  14. Zhang, Y., Cao, Q., Hu, P., Cui, H., Yu, X., and Ye, Z. (2017) Investigation on the differentiation of two Ustilago esculenta strains—implications of a relationship with the host phenotypes appearing in the fields. BMC Microbiol 17: 228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Zhang, Y., Yin, Y., Hu, P., Yu, J., Xia, W., Ge, Q., et al. (2019) Mating-type loci of Ustilago esculenta are essential for mating and development. Fungal Genet Biol 125: 60–70. [DOI] [PubMed] [Google Scholar]
  16. Zhang, Z., Xu, S., Kong, M., Dai, H., Liu, Y., and Miao, M. (2020) Isolation, identification and artificial inoculation of Ustilago esculenta on Zizania latifolia. Hortic Plant J 7: 347–358. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Microbes and Environments are provided here courtesy of Nakanishi Printing

RESOURCES