Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Goat Anti-Mouse IgG H&L (HRP) preadsorbed | Abcam | ab97040, RRID: AB_10698223 |
| Goat Anti-Mouse IgM mu chain (HRP) preadsorbed | Abcam | ab98679, RRID: AB_10696527 |
| Goat Anti-Human IgG Fc (HRP) preadsorbed | Abcam | ab98624, RRID: AB_10673832 |
| Normal Human Serum | ThermoFisher | 31876, RRID: AB_2532169 |
| Goat anti-Mouse IgG H&L (10nm gold) | Abcam | ab39619, RRID: AB_954440 |
| ACK Lysis Buffer | Gibco | A10492–01 |
| Live/Dead Violet Stain | Invitrogen | L34955 |
| αCD16/32 Fc block | Tonbo Biosciences | 70–0161-M001 |
| CD3e-BUV395 | BD Biosciences | BD 565992, RRID: AB_2739443 |
| CD4-AF700 | BioLegend | BioLegend 100536, RRID: AB_493701 |
| CD8a-PE-Cy7 | BD Biosciences | BD 552877, RRID: AB_394506 |
| CD19-BV785 | BioLegend | BioLegend 115543, RRID: AB_11218994 |
| B220-APC | BioLegend | BioLegend 103212, RRID: AB_312997 |
| NK1.1-BV421 | BD Biosciences | BD 562921, RRID: AB_2728688 |
| CD44-APC-Cy7 | BD Biosciences | BD 560568, RRID: AB_1727481), |
| CD62L-BUV563 | BD Biosciences | BD 741230, RRID: AB_2870784 |
| BD Brilliant Stain Buffer | BD Biosciences | BD 566349 |
| Foxp3 Fix/Perm | ThermoFisher | 00-5523-00 |
| Normal rat serum | Invitrogen | 10710C, RRID: AB_2532985 |
| Foxp3 isotype control antibody | Invitrogen | 45-4321-80, RRID: AB_906259 |
| Foxp3-PerCPCy5.5 antibody | Invitrogen | 45-5773-82, RRID: AB_914351 |
| Bacterial and virus strains | ||
| Mycobacterium smegmatis mc2155 | Snapper et al., 1990 | NC_008596 |
| Mycobacteriophage Che8 | Pedulla et al., 2003 | AY129330.1 |
| Mycobacteriophage Che8 Δ110-1 | This paper | N/A |
| Mycobacteriophage Myrna | Hatfull et al., 2010 | EU826466 |
| Mycobacteriophage Corndog | Pedulla et al., 2003 | AY129335 |
| Mycobacteriophage Fionnbharth | Pope et al., 2015 | JN831653 |
| Mycobacteriophage Omega | Pedulla et al., 2003 | AY129338 |
| Mycobacteriophage Nebkiss | Pope et al., 2015 | MK016501 |
| Biological samples | ||
| Mouse sera | This paper | N/A |
| Mouse spleens | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| 3,3′,5,5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA | Sigma Aldrich | Cat# T0440–1 |
| Carbonate-bicarbonate buffer capsules | Sigma Aldrich | Cat. # C3041 |
| Sulfuric acid | EMD Millipore | CAS: 7664-93-9 |
| ECL substrate | https://www.thermofisher.com/order/catalog/product/34580 | |
| Imperial protein stain | Fisher Scientific | Cat# 4615 |
| Sequencing grade modified trypsin | Promega | Cat#V5113 |
| Chymotrypsin | Sigma | Cat#C3142 |
| Critical commercial assays | ||
| Deposited data | ||
| Mass spectrometry proteomics data | ProteomeXchange Consortium via PRIDE | PXD041690 and 10.6019/PXD041690 |
| Mycobacteriophage Che8 Δ110-1 cryo-EM capsid map | EMDB | EMD-28761 |
| Mycobacteriophage Che8 Δ110-1 raw cryo-EM data | EMPIAR | EMPIAR-11285 |
| Supplemental Data Set 1 | Mendeley | 10.17632/49hmcxgjnr.2 |
| Supplemental Data Set 2 | Mendeley | 10.17632/49hmcxgjnr.2 |
| Supplemental Data Set 3 | Mendeley | 10.17632/49hmcxgjnr.2 |
| Supplemental Data Set 4 | Mendeley | 10.17632/49hmcxgjnr.2 |
| Western blot raw images | Mendeley | 10.17632/49hmcxgjnr.2 |
| Experimental models: Cell lines | ||
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J | Jackson Laboratory | 000664, RRID: JAX:000664 |
| IFNβ-EYFP reporter mice (C57BL/6J background) | Jackson Laboratory | 10818, RRID: JAX:010818 |
| Oligonucleotides | ||
| Forward primer for sgRNA plasmid construction: GGGAGAGTGCGGCGTGGAGCTGGTC | This paper | N/A |
| Reverse primer for sgRNA plasmid construction: AAACGACCAGCTCCACGCCGCACTC | This paper | N/A |
| Recombinant DNA | ||
| Plasmid pIRL53 | Rock et al., 2017 | |
| Software and algorithms | ||
| OriginLab | Version 10.05(2023b) | |
| FlowJo | Version v10.8.1 | |
| Gen5 Microplate Reader and Imager Software | BioTek | TS Installation Version 2.06.10 |
| Mascot Server version 2.7.0 | Matrix Science | https://www.matrixscience.com/ |
| Other | ||