| Chemicals, Peptides, and Recombinant Proteins |
| 2,2,2-Tribromoethanol (Avertin) |
Sigma Aldrich |
Cat# T48402-100G |
| UltraPure™ 0.5M EDTA, pH 8.0 |
Thermo Fisher Scientific |
Cat# 15575020 |
| PBS, pH 7.4 |
Thermo Fisher Scientific |
Cat# 10010049 |
| Slide-A-Lyzer™ Dialysis Cassettes, 10K MWCO, 3 mL |
Thermo Fisher Scientific |
Cat# 66380 |
| VWR brand, razor blades, 0.009” |
VWR |
Cat# 55411-050 |
| Miltex® Disposable Biopsy Punches with Plunger System 1.5mm |
AliMed |
Cat# 98PUN6-2 |
| Miltex® Disposable Biopsy Punches with Plunger System 2mm |
AliMed |
Cat# 98PUN6-3 |
| 0.1% sodium dodecyl sulfate |
Teknova |
Cat# S0180 |
| EZ Prep lysis buffer |
Sigma Aldrich |
Cat# NUC-101 |
| UltraPure™ BSA |
Thermo Fisher Scientific |
Cat# AM2618 |
| Hoechst 33342, 10 mg/mL Solution in Water |
Thermo Fisher Scientific |
Cat# H3570 |
| Recombinant RNase Inhibitor |
Takara |
Cat# 2313B |
| Critical Commercial Assays |
| RNeasy 96 Kit |
Qiagen |
Cat# 74181 |
| Qubit™ 1X dsDNA HS Assay Kit |
Thermo Fisher Scientific |
Cat# Q33231
|
| Quant-iT™ dsDNA Assay Kit, high sensitivity |
Thermo Fisher Scientific |
Cat# Q33120
|
| Illumina Tagment DNA Enzyme and Buffer large Kit |
Illumina |
Cat# 20034198 |
| Agencourt AMPure XP, 60 mL |
Beckman Coulter |
Cat# A63881 |
| SMARTScribe™ Reverse Transcriptase |
Takara |
Cat# 639538 |
| KAPA HiFi HotStart ReadyMix PCR Kit |
Roche |
Cat# 07958935001 |
| Visium Spatial Tissue Optimization Reagents Kit |
10X Genomics |
Cat# 1000193 |
| Visium Spatial Gene Expression Reagent Kit |
10X Genomics |
Cat# 1000184 |
| Chromium Single Cell 3’ GEM & Gel Bead Kit v3.1 |
10X Genomics |
Cat# 1000121 |
| Chromium Single Cell 3’ Library Construction Kit |
10X Genomics |
Cat# 1000121 |
| Deposited Data |
| scRNA-seq of SVZ |
Dulken et al.,27
|
Bioproject:PRJNA450425 |
| 10X Sagittal Visium Dataset Anterior |
https://www.10xgenomics.com/resources/datasets/mouse-brain-serial-section-1-sagittal-anterior-1-standard-1-0-0
|
10xgenomics.com: V1_Mouse_Brain_Sagittal_Anterior |
| 10X Sagittal Visium Dataset Posterior |
https://www.10xgenomics.com/resources/datasets/mouse-brain-serial-section-1-sagittal-posterior-1-standard-1-0-0
|
10xgenomics.com: V1_Mouse_Brain_Sagittal_Posterior |
| 10X Coronal Visium Dataset |
https://www.10xgenomics.com/resources/datasets/mouse-brain-section-coronal-1-standard-1-0-0
|
10xgenomics.com: V1_Adult_Mouse_Brain |
| SS2 scRNA-seq of grey/white matter microglia |
Safaiyan et al.,51
|
GEO:GSE166548
|
| Bulk-RNA microarray of microglia from various regions |
Grabert et al.,52
|
GEO:GSE62420
|
| SS2 scRNA-seq of microglia from various regions |
Tabula Muris Consortium et al.,19
|
GEO:GSE109774
|
| Bulk-seq of brain regions (aging) |
This paper |
GEO:GSE212336
|
| Nuc-seq of the mouse hippocampus and caudate putamen at young and old age |
This paper |
GEO:GSE212576
|
| Spatial transcriptomics of the mouse brain across three age groups |
This paper |
GEO:GSE212903
|
| Bulk-seq of brain regions (rejuvenation) |
This paper |
GEO:GSE227689
|
| Nuc-seq of the mouse hippocampus under dietary restriction |
This paper |
GEO:GSE227515
|
| Experimental Models: Organisms/Strains |
| C57BL/6JN |
NIA |
N/A |
| C57BL/6J |
Jackson Laboratory |
000664 |
| C3B6F1 |
Max-Planck-Institute for Biology of Ageing |
N/A |
| Oligonucleotides |
| SS2 Oligo-dT30VN: AAGCAGTGGTATCAACGCAGAGTACTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTVN |
Integrated DNA Technologies |
N/A |
| Software and Algorithms |
| Custom analysis software |
This paper |
https://github.com/OliInTheValley/SpatioTemporal_Analysis
|
